Search Strains

More Fields
Strain Species Genotype Add
MT17997 C. elegans mir-235(n4504) I. Show Description
Deletion breakpoints are: ATCGGCCATCAGAACAGTGCAAGAAAT / TTGAGAAATATG...ATCCACAGGTGGT / GTCATCTGAAGAAAGGACACACATACATA. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
MT18037 C. elegans mir-75(n4472) X. Show Description
Deletion covering bases 34070-36042 on T24D8. This is a complete deletion of mir-75, which is on T24D8 (34374-34395).
MT18043 C. elegans mir-240&mir-786(n4541) X. Show Description
Deletion breakpoints are: TTGTTGGAGAAATGAATAAA / TGGAACAAAATTAAGAATA...AATGTTTATTATGTTGCAAG / TCTACAAAATTAGGGAACA. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
MT19085 C. elegans hlh-2(n5287) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP n5287 homozygotes (embryonic lethal). Homozygous hT2 [bli-4 let-? qIs48] inviable. Pick wild-type GFP and check for correct segregation of progeny to maintain. n5287 is a 2,694 bp deletion (flanking seq 5' - TGCAACTGCCGCCATTGCTC 3' - AAAACTCTCTAGCATATTGT) and 25 bp insertion (TCTGCCATCATTGCTGCCATTGCTC). Reference: Nakano S, Ellis RE, Horvitz HR. Development. 2010 Dec;137(23):4017-27.
MT9455 C. elegans tbh-1(n3247) X. Show Description
n3247 is a 791 bp deletion which results in a truncated TBH-1 protein. Hypersensitive to 5-HT. Reduced locomotion rate.
MT9772 C. elegans mod-5(n3314) I. Show Description
Serotonin hypersensitive. Isolated as a 1688 bp deletion. Backcrossed 6 times using PCR as the assay to follow mutant chromosome. 5-HT hypersensitivity phenotype does segregate after 6 backcrosses. Hyperslowing in locomotion assay as well.
MT9940 C. elegans dpl-1(n3316) unc-4(e120)/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
Heterozygotes are WT and segregate WT, DpyUnc and Sterile Unc-4s. n3316 is Mel. 1422 bp deletion removes cosmid T23G7 nt 5200-6621.
MX124 C. elegans ifta-1(nx61) X. Show Description
Homozygous viable with no obvious morphological, locomotory, or behavioral phenotypes. However, these animals display cilia-related chemosensory (Che) defective and dye-fill (Dyf) defective phenotypes. 2009 bp deletion with flanking sequences of GATAAGAGGAAATCTTTTTGGAGAGTTGGA and ATTTAGTTTTTCACAAAGAACACCGCAATA.
MX52 C. elegans bbs-8(nx77) V. Show Description
Displays Dyf, Che and Odr phenotypes. nx77 is a double deletion in bbs-8. Nucleotides 612-759 and 826-1631 of bbs-8 (numbers refer to unspliced gene sequence) are removed.
N2 C. elegans C. elegans wild isolate. Show Description
C. elegans var Bristol. Generation time is about 3 days. Brood size is about 350. Also CGC reference 257. Isolated from mushroom compost near Bristol, England by L.N. Staniland. Cultured by W.L. Nicholas, identified to genus by Gunther Osche and species by Victor Nigon; subsequently cultured by C.E. Dougherty. Given to Sydney Brenner ca. 1966. Subcultured by Don Riddle in 1973. Caenorhabditis elegans wild isolate. DR subclone of CB original (Tc1 pattern I). [NOTE: This stock might carry a ~1.8 kb deletion in alh-2 in the background. (UPDATE: 03/26/2018 - a user reported the stock they received was homozygous for the alh-2(ot588) mutation.)]
NA649 C. elegans feh-1(gb561)/qC1 [dpy-19(e1259) glp-1(q339)] III. Show Description
Heterozygotes are WT and segregate WT, DpySteriles, dead eggs, and arrested L1 larvae (feh-1 homozygotes). feh-1 corresponds with some modification to Y54F10AM.2. feh-1(gb561) is a double deletion within feh-1 and is a null mutation.
NA653 C. elegans feh-1(gb561)/sC1(s2023) [dpy-1(s2170)] III. Show Description
Heterozygotes are WT and segregate WT, Dpy, dead eggs, and arrested L1 larvae (feh-1 homozygotes). feh-1corresponds with some modification to Y54F10AM.2. feh-1(gb561) is a double deletion within feh-1 and is a null mutation.
NA654 C. elegans kal-1(gb503) I. Show Description
Male tail structure defective. kal-1(gb503) is a 2121 bp deletion (14678 to 12577 in cosmid K03D10). Putative null allele.
NC279 C. elegans del-1(ok150) X. Show Description
2 kb deletion mutant made by OMRF Knockout Group. Presumptive null. No obvious phenotype. Primers used: EL1: GAAACGGTGAGTGCCAATTT. ER1: AGTGCTGTCACACCAAGCAC. IL1: AAACCAACTGACCCAAGGTG. IR1: TATCTAGGGTCCGCACAACC. Left breakpoint sequence: AGGTTGACAAATTGTTGCGA. Right breakpoint sequence: CGCTTATTAAAAAATAATAT.
NC292 C. elegans acr-5(ok182) III. Show Description
No obvious phenotype. 1.5 kb deletion of acr-5 produced by Moulder/Barstead at OMRF. Left breakpoint sequence: TGGGTGATGCTATATGCACA. Right breakpoint sequence: TAGACTTCCGAGCAATAATTC.
NC293 C. elegans acr-5(ok180) III. Show Description
No obvious phenotype. 2 kb deletion of acr-5 produced by Moulder/Barstead at OMRF. Deletion removes all 4 transmembrane domains. This is likely a null allele. Left breakpoint sequence (includes repeated sequence): TTTTTAATTATCCGTAATTTTTTAATTATCCGTAAT. Right breakpoint sequence: AACATCTTTAATCGATTTAT.
NC467 C. elegans acr-5(ok205) III. Show Description
No obvious phenotype. 2.4 kb deletion of acr-5 produced by Moulder/Barstead at OMRF.
NG3124 C. elegans dsh-2(or302)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
mIs14 [myo-2p::GFP + pes-10p::GFP]. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP+ heterozygotes, Dpy bright GFP+ (mIn1 homozygotes), and non-GFP or302 homozygotes. Pick WT dim GFP and check for correct segregation of progeny to maintain. or302 homozygotes are GFP- and are Emb, ABar and have EMS spindle misalignment. or302 is a deletion starting at 503 and ending at 1578 of C27A2.6.
NG324 C. elegans wsp-1(gm324) IV. Show Description
Low penetrance (about 25%) embryonic lethality and reduced brood size. wsp-1(gm324) is an N-terminal deletion that exhibits no observable mRNA or protein.
NH3119 C. elegans F54A5.3a(ok198) I. Show Description
No obvious phenotype. The primers used to isolate (ok198)were: LS969.E1: TGAGCTCGGAGATGTTGCT; LS969.E2: CCGGTCATTCCTCATTCACT; LS969.I1: GGGAGGGTCTTACGTTGTGA; LS969.I2: GTCGAAAAATCAACTTGCGG; The deletion band runs at about 2000bp. The wt band (based on the inside primers) is 3195bp making the deletion about 1200bp of the gene F54A5.3.
NK2511 C. elegans ddr-2(qy64[LoxP]) X. Show Description
CRISPR-engineered deletion of ddr-2. Low penetrance Rup. Reference: Park K, et al. eLife. 2023 Jul 5;12:RP87037. doi: 10.7554/eLife.87037. PMID: 37405383.
NL1000 C. elegans cdh-3(pk87) III. Show Description
2.6 kb deletion. pk87 homozygotes have a variable defect in hyp10 morphogenesis; most obvious in L1-L2 larvae. Rescued by WT copy of cdh-3 present on cosmid ZK112.
NL1106 C. elegans prk-2(pk278) III. Show Description
Deletion between: (exon 2): CCCAGAAGGCTT and (intron 4): ATATATATATATAGAC (complex rearrangement in between).
NL1242 C. elegans acy-2(pk465) V; pkEx467. Show Description
pkEx467 [acy-2(+) + rol-6(su1006)]. pk465 was isolated from a chemical deletion library and has a deletion of the first catalytic domain and the two multiple transmembrane regions of the predicted ACY-2 protein. The phenotype of pk465 is early larval lethality. The lethal phenotype of pk465 is rescued in NL1242 by a transgene containing WT acy-2 (cosmid C10F3) and rol-6.
NL130 C. elegans pgp-1(pk17) IV; pgp-3(pk18) X. Show Description
Drug sensitive. No visible phenotype. pgp-1 and pgp-3 deletion alleles.
NL131 C. elegans pgp-3(pk18) X. Show Description
pgp-3 deletion allele. No visible phenotype. Drug sensitive (colchicine, chloroquine). Throws males: outcrossed with him-8(e1489) so probably contains this mutation.
NL132 C. elegans pgp-1(pk17) IV. Show Description
pgp-1 deletion allele. No visible phenotype. Might be sensitive to drugs.
NL147 C. elegans mrp-1(pk89) Show Description
mrp-1 deletion mutant. WT under normal lab conditions. Sensitive to cadmium and arsenite.
NL152 C. elegans pgp-1(pk17) IV; pgp-3(pk18) X; mrp-1(pk89) Show Description
pgp-1, pgp-3 and mrp-1 triple deletion mutant. Hypersensitive to cadmium and arsenite.
NL2001 C. elegans gpb-2(pk751) I. Show Description
Flanking sequence: AGTCACTCTT - deletion - GAAGACTACT.
NL2003 C. elegans ric-19(pk690) I. Show Description
pk690 is a deletion allele within the gene C32E8.7. The deletion is stable in the homozygous state and has no obvious phenotype. Can verify the presence/homozygosity of the deletion by PCR using the following primers: AL1: 5'-CGACGACACTCCATTATTCC-3' AR1: 5'-CCAGTCCTGCAAAAATGCTC-3'. A product of about 3.7 kb is obtained from WT worms, while a product of about 1 kb is obtained from NL2003 worms. The deletion has been sequenced and covers position -354 to +2276.
NL2098 C. elegans rrf-1(pk1417) I. Show Description
Homozygous rrf-1 deletion allele. RNAi interference for genes expressed in somatic tissue is lost in rrf-1 deletion mutants.
NL2099 C. elegans rrf-3(pk1426) II. Show Description
Homozygous rrf-3 deletion allele. Increased sensitivity to RNAi when compared to WT animals. Deletion sequence (deletion in lower case letters, flanking undeleted sequence in capital letters): TGCACATATTctacagaatt ------- --------tacccgattaAATGGACAATT (from Plasterk Lab 11/05).
NL2550 C. elegans ppw-1(pk2505) I. Show Description
ppw-1 animals are resistant to feeding of ds RNA directed against germline genes. Multiple polymorphisms in C18E3.7 including a single base deletion in ppw-1 resulting in an early stop codon.
NL3511 C. elegans ppw-1(pk1425) I. Show Description
ppw-1 animals are resistant to feeding of ds RNA directed against germline genes. The genomic region that is deleted: nt 2479-3982 of C18E3 (intragenic deletion in C18E3.7). This strain was formerly called NL2557.
NL361 C. elegans gpb-1(pk44) II; pkEx170. Show Description
pkEx170 [gpb-1(+) + rol-6(su1006)]. Rollers. Pick Rollers to maintain. NL361 is homozygous for the gpb-1 deletion allele pk44; this results in an L1 arrest if the larvae has maternally derived GPB-1 or in an early embryonic lethality if there is no maternally derived GPB-1 for the developing embryo. This phenotype is rescued by the extrachromosomal transgene which contains the WT gpb-1 gene.
NL594 C. elegans gpa-12(pk322) X. Show Description
Deletion sequence: Flanking undeleted sequence in uppercase, deleted sequence in lower case: CGGTGAATCTggaaagtccacg . . . aaatgcttatTCACAATGTT .
NL791 C. elegans prk-2(pk439) I. Show Description
Homozygous prk-2 deletion allele.
NLS1 C. elegans cdc-7(knu709) I. Show Description
CRISPR-engineered deletion removing entire cdc-7 gene. Out-crossed 3x to N2. Reference: Currey HN & Liachko NF. 2019. A CRISPR/Cas9-generated cdc-7 loss of function mutation does not cause temperature-dependent fertility defects. microPublication Biology. Jan 3;2019:10.17912.
NM1278 C. elegans rbf-1(js232) III. Show Description
Lethargic in the absence of stimulation. 1500 bp deletion including the promoter and first three exons of C. elegans rabphilin homolog.
NM1568 C. elegans ehs-1(ok146) II. Show Description
An approx. 1-8 kb deletion in the ZK1248.3 gene which encodes a C. elegans homolog of the Eps15 (vertebrate) and pan1 (S. cervesisiae) gene. No obvious behavioral or morphological phenotypes.
NM1581 C. elegans rpy-1(ok145) II. Show Description
Viable, fertile, with no obvious behavioral or morphological phenotypes. A 1677 bp deletion in the C18H9.7 gene which encodes a C. elegans homolog of the rapysn (vertebrate) gene. The lesion deletes exons 4 through 10, leaving exons 3 and 11 in frame. The deletion junction is cagaagaaaaagttcgctttgaactaaAGAACCTATTGAAAATTCTTACTT. Previously called rap-1.
NM1657 C. elegans unc-10(md1117) X. Show Description
Uncoordinated and aldicarb resistant. Molecular lesion: deletion of entire unc-10 coding region. Gene encodes C. elegans homolog of Rab3 interacting molecule. Will mate, but poorly.
NM204 C. elegans snt-1(md290) II. Show Description
snt-1 encodes the C. elegans homolog of synaptotagmin I. md290 is a deletion that removes most of the coding sequence. Strain is a slow growing aldicarb resistant (Ric) Unc. Males won't mate.
OD2174 C. elegans unc-119(ed3) III; mdf-2(lt4::loxP::Cbr-unc-119(+)::loxP) IV/nT1 [qIs51] (IV;V). Show Description
CRISPR/Cas9 engineered deletion of mdf-2 in which the mdf-2 coding sequence was replaced by unc-119. Heterozygotes are wild-type GFP+ and segregate mdf-2 null homozygotes (low brood size/embryonic lethal), wild-type GFP+ heterozygotes, and arrested nT1[qIs51] aneuploids. Pick wild-type GFP+ and check for correct segregation of progeny to maintain. Unknown if unc-119(ed3) from parental strain is still carried in the background. gRNA sequence: Gccaaattccccagttttag Reference: Lara-Gonzalez P, et al. Dev Cell. 2019 Nov 4;51(3):313-325.e10. doi: 10.1016/j.devcel.2019.09.005. PMID: 31588029.
OD2359 C. elegans fzy-1(lt20::loxP)/mIn1[mIs14 dpy-10(e128)] II. Show Description
CRISPR/Cas9 engineered deletion of fzy-1 in which the fzy-1 coding sequence was replaced by LoxP. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are wild-type with relatively dim pharyngeal GFP signal, and segregate wild-type dim GFP (heterozygotes), Dpy bright GFP (mIn1 homozygotes), and non-GFP fzy-1 homozygotes (larval arrest). Pick wild-type with dim GFP and check for correct segregation of progeny to maintain. gRNA sequence: Ggacgcacgcccggtagtgc Reference: Kim T, et al. Genes Dev. 2017 Jun 1;31(11):1089-1094. doi: 10.1101/gad.302067.117. PMID: 28698300.
OD3737 C. elegans cyb-3(lt110) V/nT1 [qIs51] (IV;V). Show Description
CRISPR/Cas9 engineered deletion of cyb-3. Heterozygotes are wild-type GFP+ and segregate mdf-2 null homozygotes (embryonic lethal), wild-type GFP+ heterozygotes, and arrested nT1[qIs51] aneuploids. Pick wild-type GFP+ and check for correct segregation of progeny to maintain. gRNA sequences: tcaggtcgacattcttggcc & gttatgggtatgagagcatt Reference: Lara-Gonzalez P, et al. Dev Cell. 2019 Nov 4;51(3):313-325.e10. doi: 10.1016/j.devcel.2019.09.005. PMID: 31588029.
OE3002 C. elegans him-8(e1489) IV; xbx-1(ok279) V. Show Description
Dyf. Osm. Throws males. Reduced mating efficiency (ME 2-3). Deletion extends over 1610 bp in the intron between exons 3 and 4 and ending 30 bp after the STOP codon (cosmid F02D8 pb 25954-27563 are deleted). Complements dyf-4(m158).
OF1355 C. elegans hda-3(ix261) I. Show Description
Shortened locomotor healthspan. ix261 missense allele causes phenotype similar to that of deletion alleles. Reference: Kawamura K, & Maruyama IN. Aging (Albany NY). 2020 Dec 3;12(23):23525-23547.
OG1156 C. elegans ogt-1(dr93[delta-TPR domain]) III; drIs4 IV. Show Description
drIs4 [gpdh-1p::GFP + col-12p::DsRed] IV. TPR domain deleted in the endogenous ogt-1 locus using CRISPR/Cas9; Sanger sequence confirmed. The TPR domain deletion (128 aa - 583 aa) ablates the O-GlcNAcylation activity of OGT-1 as measured by the RL2 O-GlcNAc antibody. Defective gpdh-1p::GFP induction in the hypodermis and intestine during hypertonic stress. Constitutive col-12p::DsRed expression. Impaired adaptation to hypertonic stress. Reference: Urso SJ, et al. (2020). The O-GlcNAc transferase OGT is a conserved and essential regulator of the cellular and organismal response to hypertonic stress. bioRxiv, 2020.2005.2001.072033.