Strain Information
| Name | NH3119 View On Wormbase |
|---|---|
| Species | C. elegans |
| Genotype | F54A5.3a(ok198) I. |
| Description | No obvious phenotype. The primers used to isolate (ok198)were: LS969.E1: TGAGCTCGGAGATGTTGCT; LS969.E2: CCGGTCATTCCTCATTCACT; LS969.I1: GGGAGGGTCTTACGTTGTGA; LS969.I2: GTCGAAAAATCAACTTGCGG; The deletion band runs at about 2000bp. The wt band (based on the inside primers) is 3195bp making the deletion about 1200bp of the gene F54A5.3. |
| Mutagen | UV/TMP |
| Outcrossed | x4 |
| Made by | G Moulder |
| Laboratory | NH |
Sign in
or
register an account if you want to order this strain.