Strain Information
| Name | MX124 View On Wormbase |
|---|---|
| Species | C. elegans |
| Genotype | ifta-1(nx61) X. |
| Description | Homozygous viable with no obvious morphological, locomotory, or behavioral phenotypes. However, these animals display cilia-related chemosensory (Che) defective and dye-fill (Dyf) defective phenotypes. 2009 bp deletion with flanking sequences of GATAAGAGGAAATCTTTTTGGAGAGTTGGA and ATTTAGTTTTTCACAAAGAACACCGCAATA. |
| Mutagen | Tc1 |
| Outcrossed | x8 |
| Made by | Chunmei Li |
| Laboratory | MX |
Sign in
or
register an account if you want to order this strain.