Homozygous viable with no obvious morphological, locomotory, or behavioral phenotypes. However, these animals display cilia-related chemosensory (Che) defective and dye-fill (Dyf) defective phenotypes. 2009 bp deletion with flanking sequences of GATAAGAGGAAATCTTTTTGGAGAGTTGGA and ATTTAGTTTTTCACAAAGAACACCGCAATA.

C54G7,4. External left primer: ACAATCGGAAAATTGCCAAG. External right primer: TAGATTACGCGGAGCGAAGT. Internal left primer: TTCCATATCGTGACACAGCG. Internal right primer: CCACGCCCTCAGTAAGGTAA. Internal WT amplicon: 2412 bp. Deletion size: 679 bp. Deletion left flank: TGATTTGCATCAGCGATGAATTGTGCTTTC. Deletion right flank: CACACTCAAAACCTTTCAGTACTTCATTAG. Insertion Sequence: GTGTGACCAAGCTGTTGAATGCTATTTAAGACGGAGCCTGCCACAGAAAGCATTGCACG CGTGTAAAGAGCTGAATCAGTGG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

sEx13645 [rCesC04F12.5::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).