Strain Information
| Name | MT19085 View On Wormbase |
|---|---|
| Species | C. elegans |
| Genotype | hlh-2(n5287) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). |
| Description | Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP n5287 homozygotes (embryonic lethal). Homozygous hT2 [bli-4 let-? qIs48] inviable. Pick wild-type GFP and check for correct segregation of progeny to maintain. n5287 is a 2,694 bp deletion (flanking seq 5' - TGCAACTGCCGCCATTGCTC 3' - AAAACTCTCTAGCATATTGT) and 25 bp insertion (TCTGCCATCATTGCTGCCATTGCTC). Reference: Nakano S, Ellis RE, Horvitz HR. Development. 2010 Dec;137(23):4017-27. |
| Mutagen | EMS |
| Outcrossed | x4 |
| Made by | Shunji Nakano |
| Laboratory | MT |
Sign in
or
register an account if you want to order this strain.