Search Strains

More Fields
Strain Species Genotype Add
LX980 C. elegans ocr-4(vs137) IV; ocr-1(ok132) V. Show Description
vs137 is a deletion allele. A "T" has been added. The endpoints of the deletion are: TCGAACGTCAACAACATATTGCAAAT.......T.......TTGGAAAGGTAGGCTTAC ACTTTTTTTAA. Double mutants have reduced AWA gene expression. ok132 is a deletion and putative null allele. The boundaries of the deletion are: AGATTACTGATGCCATTGAACAAGTTCTCGTCA......TGATGTTTGAAAGGTGGAGT AGCAAAGAGA.
LX981 C. elegans ocr-4(vs137) ocr-2(ak47) IV. Show Description
ak47 is chemosensory, mechanosensory and osmosensory defective, and is a null allele. vs137 is a deletion allele. A "T" has been added. The endpoints of the deletion are: TCGAACGTCAACAACATATTGCAAAT.......T.......TTGGAAAGGTAGGCTTAC ACTTTTTTTAA.
LY100 C. elegans slo-2(nf100) X. Show Description
Hypersensitive to hypoxia. Deletion corresponds to base pairs 13056-13629 in the published F08B12 sequence (genebank accession # Z68104).
LY101 C. elegans slo-2(nf101) X. Show Description
Hypersensitive to hypoxia. Deletion corresponds to base pairs 13009-13380 in the published F08B12 sequence (genebank accession # Z68104).
LY110 C. elegans B0399.1(nf110) V. Show Description
Temperature sensitive Egl and Unc. 318 pb deletion including exons 6 and 7. Possibly an allele of exp-3.
LY120 C. elegans twk-7(nf120) III. Show Description
A deletion in F22B7.7 corresponding to base pairs #9512-9815 in the published C. elegans cosmid F22B7 sequence (Genbank accession #L120180. Predicted protein F22B7.7 is part of a family of 2-pore domain potassium channels.
LY130 C. elegans twk-20(nf130) X. Show Description
A 1215 bp deletion in C40C9.1 corresponding to base pairs #9009-10223 in the published C. elegans cosmid C40C9 sequence (Genbank accession #Z70266).
LY140 C. elegans F44A2.2(nf140) V. Show Description
A 150 bp deletion in F44A2.2 corresponding to base pairs #27451-27600 in the published C. elegans cosmid F44A2 sequence (Genbank accession #U41993). The predicted protein F44A2.2 is called "nshab1", which is homologous to potassium voltage-gated channel subfamily B, member 2.
MAH914 C. elegans sqst-1(syb764) IV. Show Description
Full CRISPR deletion of sqst-1 locus. Reference: Kumsta C, et al. Nat Commun. 2019 Dec 11;10(1):5648.
MCJ11 C. elegans mir-35(cdb2 cdb4) II. Show Description
Superficially wild-type. Seed mutation of mir-35 was made by two rounds of CRISPR/Cas9 editing. cdb2 is a 50 bp deletion of the mir-35 locus. cdb4 was created by successive homology-directed repair of the disrupted mir-35 locus with a protospacer to preserve the secondary structure of the primary and precursor hairpin. Reference: Yang B, et al. Genes Dev. 2020 Sep 1;34(17-18):1227-1238. PMID: 32820039
MCJ217 C. elegans mir-35(cdb2 cdb4) II; egl-1(cdb97) V. Show Description
Superficially wild type. Seed mutation of mir-35 was made by two rounds of CRISPR/Cas9 editing. cdb2 is a 50 bp deletion of the mir-35 locus. cdb4 was created by successive homology-directed repair of the disrupted mir-35 locus with a protospacer to preserve the secondary structure of the primary and precursor hairpin. egl-1(cdb97) contains engineered mutations in mir-35 binding site in the 3’UTR region making the sequence complementary to the mir-35(cdb4) variant. Reference: Yang B, et al. Genes Dev. 2020 Sep 1;34(17-18):1227-1238. PMID: 32820039
MD792 C. elegans ced-13(sv32) X. Show Description
Deletion allele.
ML1150 C. elegans mlc-4(or253)/qC1 [dpy-19(e1259) glp-1(q339)] III; mcEx401. Show Description
mcEx401 [mlc-4p::GFP::mlc-4(WT) + pie-1p::GFP::mlc-4(WT) + rol-6(su1006)]. Rollers. Apparent homozygous lethal deletion chromosome balanced by glp-1- and dpy-19-marked recombination suppressor. Heterozygotes are WT Rol, and segregate WT Rol, sterile Dpy (qC1 homozygotes), late embryonic - early larval lethal (mlc-4 homozygotes) and Sterile Rollers. Pick WT Rol and check for correct segregation of progeny to maintain. Reference: Gally C et al. Development. 2009 Sep;136(18):3109-19.
ML1151 C. elegans mlc-4(or253)/qC1 [dpy-19(e1259) glp-1(q339)] III; mcEx402. Show Description
mcEx402 [mlc-4p::GFP::mlc-4(DD) + pie-1p::GFP::mlc-4(WT) + rol-6(su1006)]. Rollers. Apparent homozygous lethal deletion chromosome balanced by glp-1- and dpy-19-marked recombination suppressor. Heterozygotes are WT Rol, and segregate WT Rol, sterile Dpy (qC1 homozygotes), late embryonic - early larval lethal (mlc-4 homozygotes) and Sterile Rollers. Pick WT Rol and check for correct segregation of progeny to maintain. Reference: Gally C et al. Development. 2009 Sep;136(18):3109-19.
ML581 C. elegans lin-26(mc15) unc-4(e120)/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
Heterozygotes are WT and segregate dead eggs, DpyUncs and WT. lin-26(mc15) is a molecular null due to a deletion of most of lin-26 coding sequence.
ML653 C. elegans vab-10(mc44)/unc-75(e950) unc-101(m1) I. Show Description
Heterozygotes are WT and segregate WT, Uncs and dead eggs and larvae with severe body morphology defects that do not develop beyond the L2 stage. A few very rare mc44 larvae reach adulthood but they become sterile. mc 44 is a deletion affecting the downstream transcription unit of vab-10 named vab-10b. Fails to complement the vab-10 null reference allele vab-10(h1356), but complements the vab-10a alleles vab-10a(e698) and vab-10a(ju281).
ML855 C. elegans +/szT1 [lon-2(e678)] I; ppk-3(mc46)/szT1 X. Show Description
Heterozygotes are WT and segregate WT, arrested szT1 aneuploids, Lon males, mc46 hemizygotes (WT males) and mc46 homozygotes. mc46 is a deletion that results in homozygotes which show enlarged vacuoles (late endosomes and lysosomes) and lay eggs with enlarged vacuoles that die at different stages of embyronic development.
MLC113 C. elegans ttTi5606 mir-236(luc2[unc-119(+)]) II; unc-119(ed3) III. Show Description
Superficially wild-type. CRISPR/Cas9-engineered mir-236 deletion allele; miRNA hairpin replaced by unc-119.
MLC1384 C. elegans mir-1(luc108) I. Show Description
Superficially wild-type. CRISPR/Cas9-engineered mir-1 deletion allele (breakpoints: gcagaaaattactcaccattaaaacactaccacc
MLC1776 C. elegans tbx-43(luc131) III. Show Description
Wild-type morphology. CRISPR/Cas9 engineered 952 bp deletion of the tbx-43 locus. Flanking sequence: aattagtttttagctccagaagtcggggccgcgccacgttgcatgctcgg / ggcgcttatggaaaaatcattgtggcgggaattcgattcgcagtgtaatg Reference: Charest J, et al. Dev Cell. 2020 Sep 24;S1534-5807(20)30672-9. PMID: 33002421
MLC1946 C. elegans tbx-11(luc144) III. Show Description
Wild-type morphology. CRISPR/Cas9 engineered 1.3 kb deletion of the tbx-11 locus. Flanking sequence: aaaaataacaaaataacaaggaatgagaagggaaaacaggaaaaatacac / ttgccacgtgttgggcgggaaaacgcgtagtcatccggcaggtgtaacct Reference: Charest J, et al. Dev Cell. 2020 Sep 24;S1534-5807(20)30672-9. PMID: 33002421
MLC2230 C. elegans vha-1(luc161) III/hT2[bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Heterozygotes are wild-type with pharyngeal GFP signal, and segregate wild-type GFP, arrested hT2 aneuploids, and non-GFP luc161 homozygotes (embryonic lethal). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick wild-type GFP and check for correct segregation of progeny to maintain. vha-1(luc161) is a 454 bp deletion removing most of the coding sequence. Reference: Gutie?rrez-Pérez, P. et al. A deeply conserved miR-1 dependent regulon supports muscle cell physiology. bioRxiv, 2020, doi.org/10.1101/2020.08.31.275644.
MLC2312 C. elegans che-1(luc174) I. Show Description
Wild-type morphology. CRISPR/Cas9 engineered 3.38 kB deletion of the che-1 locus. Flank: caaaaacatcacaaaaataa // tataatttactgatacaata Reference: Charest J, et al. Dev Cell. 2020 Sep 24;S1534-5807(20)30672-9. PMID: 33002421
MLC237 C. elegans mir-791(luc39) X. Show Description
luc39 is a deletion of mir-791. mir-791(luc39) mutants show a decreased turning and reversal rate compared to N2 animals under conditions where the CO2 concentration is gradually increased from 0-5%. Reference: Drexel T, et al. Genes Dev. 2016 Sep 15;30(18):2042-2047.
MLC239 C. elegans mir-790(luc40) IV. Show Description
luc40 is a deletion of mir-790. luc40 mutants respond normally to CO2 as compared to mir-791(lf) animals. Reference: Drexel T, et al. Genes Dev. 2016 Sep 15;30(18):2042-2047.
MLC2543 C. elegans dct-1(luc194) X. Show Description
CRISPR/Cas9-engineered deletion removes the entire dct-1 coding sequence. Homozygote mutant animals are viable and have normal morphology. Outer left sequence: gtttcagagacgggtctttcctaaca Outer right sequence: ttccaaacaaaaattttaacgttcgactta sgRNA1: ACAGCAGACGGAGCAGTCAT sgRNA2: GTACAGTGAAATGAGGTAAG Reference: Gutie?rrez-Pérez, P. et al. A deeply conserved miR-1 dependent regulon supports muscle cell physiology. bioRxiv, 2020, doi.org/10.1101/2020.08.31.275644.
MLC349 C. elegans ttTi5606 II; unc-119(ed3) III; mir-1820(luc16[unc-119(+)]) IV. Show Description
Superficially wild-type. CRISPR/Cas9-engineered mir-1820 deletion allele; miRNA hairpin replaced by unc-119.
MLC524 C. elegans unc-2(luc27) X. Show Description
luc27 is a 300 bp deletion in the unc-2 3'UTR. Reference: Drexel T, et al. Genes Dev. 2016 Sep 15;30(18):2042-2047.
MLC618 C. elegans hbl-1(luc32) X. Show Description
luc32 is a 670 bp deletion in the hbl-1 3'UTR. Reference: Drexel T, et al. Genes Dev. 2016 Sep 15;30(18):2042-2047.
MLC698 C. elegans mir-255(luc38) V. Show Description
Superficially wild-type. CRISPR/Cas9-engineered mir-255 deletion allele removes the hairpin (breakpoints: aaactttcgttgctgcgaaat...ccattcaattaatttcccgcatttcttaatttttgagctttttctt).
MT10549 C. elegans tdc-1(n3421) II. Show Description
Forages while backing. Deletion in L-aromatic amino acid decarboxylase with homology to histidine decarboxylase. Reference: Alkema M, et al. Neuron. 2005 Apr 21;46(2):247-60.
MT10661 C. elegans tdc-1(n3420) II. Show Description
Forages while backing. Deletion in L-aromatic amino acid decarboxylase with homology to histidine decarboxylase. Reference: Alkema M, et al. Neuron. 2005 Apr 21;46(2):247-60.
MT1071 C. elegans egl-21(n476) IV. Show Description
Egl. Fails to complement daf-14 as well; small deletion or background?? [NOTE: The CGC has received reports that n476 might be heterozygous in this strain. KP2018 is an outcrossed version of this strain and has been confirmed as homozygous for n476.].
MT12945 C. elegans mir-52(n4100) IV. Show Description
Deletion breakpoints are: CTACTCCTACAACTACAACTAC / TACTACTACTATA...ATCACGTTTAAATCA / ATTTCCCAAGAGTTTTCGTATAAT. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
MT12954 C. elegans mir-1(n4101) I. Show Description
Deletion breakpoints are:TAGAGCATGTTGCCAATATTGGCAT / GAAAATATTGGCAA...TCACTTTGAATATAGCG / TAGATATAGAGTAGAATTGAATCTG. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
MT12955 C. elegans mir-1(n4102) I. Show Description
Deletion breakpoints are:CGTCAGAAGGGCGCCTTTTCCTTCG / CCTTGCCGCATCG...CGTCATTGCCGTC / TTAACAGGCATCGAATGGAAAAATTGGCG. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
MT12958 C. elegans mir-87(n4104) V. Show Description
Deletion breakpoints are:CACACACACACACACATACATA / CATACATACAT...CACACAGCCAAAA / GGGGCGGGACGACGACTCCTCCCCGCCT. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
MT12960 C. elegans epc-1(n4076) III/eT1 (III;V). Show Description
Heterozygotes are WT and segregate WT, Uncs, Ste/Mel, and dead eggs. The epc-1(n4076) deletion removes 886 nucleotides from the epc-1 locus (Y111B2A.11). Relative to the first nucleotide of the predicted initiator ATG, the deletion begins at about nt. 2014 and ends at about nt. 2899 to give the junction sequence CTTCTCTGT/CCGGCTTTA.
MT12963 C. elegans ssl-1(n4077) III/eT1 (III;V). Show Description
Heterozygotes are WT and segregate WT, Unc, Ste/Mel, and dead eggs. ssl-1(n4077) deletion removes 683 nucleotides from the ssl-1 locus (Y111B2A.23). Relative to the first nucleotide of the predicted initiator ATG, the deletion begins at about nt. 5075 and ends at about nt. 5757 to give the junction sequence GATATACAC/AGACCTAAT.
MT12969 C. elegans mir-259(n4106) V. Show Description
Deletion breakpoints are: GATTATAATGCAAACAACCTGGGGGATC / CAGTATCTTCA...AAGAGCGAAAGT / ACAGTCTCCTCCTTCTTTGCTCACTTCT. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
MT12979 C. elegans mir-70(n4110) V. Show Description
Deletion breakpoints are:TTTTTTACCGTTGAGTTTCAGAAGT / ATATTTTTTCT...ACGACGTATTA / CATTTCTTCATAAGTGTTATTCGTCGAT. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
MT12983 C. elegans mir-238(n4112) III. Show Description
Deletion breakpoints are: ACAACTTAATATCTTTTCTGGTCATTTTCAA / TACTTACCTCA...AGGTGACAGAAA / GTTGTGTGAAAATGACAAATATCTCTTTTCT. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
MT12989 C. elegans mir-53(n4113) IV. Show Description
Deletion breakpoints are: ACTCTATGATGTCCTTCAAAACAACA / TAATTTACGCCAT...CAGAATCGGGAGAAA / TTTATAATAATAGAGAGAGAGAGA. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
MT12990 C. elegans mir-52(n4114) IV. Show Description
Deletion breakpoints are: CTTACCCCCCAAACCCTG / CCGCTACTACTACTACTCCTA...GAAAGGGTAGCCGGTTATT / GAAGTTGGGTCTTTTTTGGG. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
MT12993 C. elegans mir-71(n4115) I. Show Description
Deletion breakpoints are: CGATCCCGACGGCGAAAAACAG / AATAGTGATACGAC...TGTGTGTGAGCTA / GTTTCAACACTGAGGTTTTGTTGGAAAGT. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
MT12999 C. elegans mir-85(n4117) II. Show Description
Deletion breakpoints are:TCATCTGATGACTTATCTTCA / TACTCGTGT...AACGTGATGAA / GGTCCGGATAGGGCTTGAGCTATTCGTT. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
MT13015 C. elegans mir-72(n4130) II. Show Description
Deletion breakpoints are: CTCTCTGCGGAATTATATCAATTTTCT / ACCAATTCTATA...CAGGTCGAGCACTC / GGACTCCTTCTGTGAAGTGCACCTG. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
MT13016 C. elegans nDf52 III. Show Description
nDf52 removes mir-229 and mir-64. Deletion is 652 bp from -525 to 128 from 5'end of mir-64. Reference: PLos Genet (2007) 3(12):e215.
MT13078 C. elegans mir-73&mir-74(nDf47) X. Show Description
Deletion breakpoints are: GAGAGTCCCACACACGACTGGACTTCCA / TATCGAGCCA...AATGGCAGTCTA / CACGTTTTTCAACCAAATGCTATGGCC. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
MT13113 C. elegans tdc-1(n3419) II. Show Description
n3419 is a deletion in L-aromatic amino acid decarboxylase with homology to histadine decarboxylase. Forages while backing. PKA adc-1.