Search Strains

Mild locomotory defects, sluggish response to physical stimuli, and reduced thrashing rate. Phenotype more severe than ok3. ok2 is a 1189 bp deletion (III:9519159-9520346) removing amino acids 314-693 and inserting a glutamic acid at the deletion site. Flanking sequence: GACCGACTTCCAACCAGTTACCCAG...ATGTTATGAAGTTCAATCCGGATTGTTTCTC ATCAAATGT.

Mild locomotory defects, sluggish response to physical stimuli, and reduced thrashing rate. Phenotype less severe than ok2. ok3 is a 1047 bp deletion (III:9518654-9519699) and 13 nucleotude insertion (producing two termination codons) resulting in a protein truncated at amino acid 693 plus an inserted glutamic acid. Flanking sequence: GCTCGAGGATGCTGCTCACAAACTGAAAATG...GAATAGTATCCGTGAATAGTATCCG TGAAGATTCTG.

qIs26 [lag-2::GFP + rol-6(su1006)]. Rollers. Homozygous sterile deletion allele tm1868 balanced by qC1 with rol and GFP markers. Segregates GFP + Roller heterozygotes, and non-rol non-GFP tm1868 homozygotes (sick, sterile, unc). qIs26 was integrated into qC1 and in the process made qC1 homozygous lethal. Pick Rol GFP+ and check for correct segregation of progeny to maintain. Reference: Csankovszki G, et al., Curr Biol. 2009 Jan 13;19(1):9-19.

Slightly short and fat as adults. 1376 bp deletion of part of intron 1 through intron 4. Contains an integrated hlh-8::GFP reporter marking the postembryonic M lineage.

760 bp deletion beginnin in exon 3 and ending in exon 4. No strong visible phenotype.

745 bp deletion of cdk-4 from intron I to exon3 removing putative ATP binding domain and catalytic residues. Most homozygous animals arrest at L2 due to absence of most or all postembryonic somatic cell divisions. Some germline proliferation resulting in slightly elongated gonad.

sf1003 is a CRISPR-engineered deletion in aat-1. aat-1(sf1003) mutants show elevated pumping rates and enhanced learning capacity compared to well-fed wild type animals (similar to nkat-1 mutants). Reference: Lin L, et al. Genes Dev. 2020 Aug 1;34(15-16):1033-1038. doi: 10.1101/gad.339119.120. PMID: 32675325.

Wild-type phenotype. Segregates WT, Unc-54 (hIn1[unc-54] homozygotes), dead eggs (hDf16 homozygotes). Pick WT and check for correct segregation of progeny to maintain. See WBG 14: 29. This deletion was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to Ann Rose. CGC received new stock 9/3/97.

Wild-type phenotype. Segregates WT, Unc-54 (hIn1[unc-54] homozygotes), dead eggs (hDf17 homozygotes). Pick WT and check for correct segregation of progeny to maintain. See WBG 14: 29. This deletion was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to Ann Rose. CGC received new stock 9/3/97.

Wild-type phenotype. Segregates WT, Unc-54 (hIn1[unc-54] homozygotes), dead eggs (hDf15 homozygotes). Pick WT and check for correct segregation of progeny to maintain. See WBG 14: 29. This deletion was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to Ann Rose. CGC received new stock 9/3/97.

kasEx80 [oig-1p::tagRFP::unc-54 3'UTR + pha-1(+)]. Maintain at 25C to maintain array. RFP driven by minimal oig-1 promoter for expression in VD-type GABAergic motor neurons. This construct uses the minimal length of promoter containing overlapping LIN-39 and UNC-30 ChIp-seq peaks (deletion of the single LIN-39 binding site within it compromised GABAergic motor neuron expression). Whereas other available oig-1 constructs are expressed ectopically in cholinergic motor neurons in unc-3 mutants, expression of this construct remains exclusively in GABAergic motor neurons. Reference: Feng W, et al. Elife. 2020 Jan 3;9. pii: e50065. doi: 10.7554/eLife.50065.

kasEx149 [oig-1p(2.6kb_del)::GFP::unc-54 3'UTR + myo-2p::GFP]. Pick worms with GFP+ pharynx to maintain array. Unc. 2.6kb cis-regulatory region with 200bp deletion removing predicted LIN-39 binding site upstream of oig-1 was fused to GFP. Expression of oig-1::GFP in GABAergic motor neurons is been abolished; expression was observed specifically in cholinergic motor neurons of the ventral nerve cord. Reference: Feng W, et al. Elife. 2020 Jan 3;9. pii: e50065. doi: 10.7554/eLife.50065.

kasEx151 [oig-1p(2.6kb_del)::GFP::unc-54 3'UTR + myo-2p::GFP]. Pick worms with GFP+ pharynx to maintain array. Unc. 2.6kb cis-regulatory region with 300bp deletion removing predicted LIN-39 binding site upstream of oig-1 was fused to GFP. Expression of oig-1::GFP in GABAergic motor neurons is retained, but eliminates ectopic expression in cholinergic motor neurons of the ventral nerve cord. Reference: Feng W, et al. Elife. 2020 Jan 3;9. pii: e50065. doi: 10.7554/eLife.50065.

Abnormal locomotion phenotype. 970 bp deletion.

Egl. 2.1 kb deletion.

Homozygous viable. km11 is a deletion/duplication of klc-2; see Sakamoto, et al. PMID: 15563606 for detailed description. Reference: Sakamoto R, et al. Mol Biol Cell. 2005 Feb;16(2):483-96. PMID: 15563606

At 20C heterozygotes segregate WT heterozygotes, Unc unc-34(e566) homozygotes, and Mog ife-3(ok191) homozygotes. At 25C ife-3(ok191) homozygotes are not always Mog, but progeny of the non-Mog homozygotes are embryonic lethal. Deletion of 686 bp from ife-3 removes proximal promoter and all of exon 1. Breakpoint determined by B. Keiper is: taattttcatattttccgct/tatcta/ttatcgattttttccagatg. Eukaryotic translation initiation factor 4E (eIF4E) gene (isoform 3; B0348.6); paralog of human eIF4E isoform.

No apparent phenotype. Outcrossed version of RB579. Deletion of 1628 bp removes ife-2 exon 4. Deletion extends into R04A9.3 and removes exons 1 and 2 of unknown gene. IFE-2 protein is absent from m7GTP-affinity purified protein; other IFEs are present. Breakpoint independently determined by BDK and Vancouver KO Group is AAAACAATTTTCCACTGCT/AA/TTTTTGCAAAGTATTCAATT. Eukaryotic translation initiation factor 4E gene (isoform 2).

C05D9.5 Homozygous. Deletion of 1778 bp removes 1088 bp upstream of start codon and all of exons 1 and 2. IFE-4 is absent from m7GTP-affinity purified protein; other IFEs are present. Breakpoint determined by BDK is CATCGAGTCGGGACGTGATG/AGTAGTGCAAGACTGATAAA. Eukaryotic translation initiation factor 4E gene (isoform 4).

bcIs39 [lim-7p::ced-1::GFP and lin-15(+)] V.  Resistant to germ cell apoptosis. No apoptosing germ cells are decorated by CED-1::GFP in the gonad. ced-3 deletion confirmed by genomic triple primer PCR with 5’-AGTTCACCGTGACAGCGTCTCTTC-3’, 5’-CGATTACGACTTGAACTGTATCCGA-3’, and 5’-TCTTGTGTAAACGAGATTTGCAATG-3’. Homozygous ced-3(n2452) yields only 1,110 bp product. Outcrossed heterozygotes yield both 1,411 bp (wild type ced-3) and 1,110 bp products. [NOTE: (11-05-2019) A user has reported this strain exhibits temperature-sensitive sterility when raised at 25C.]

Superficially WT. byDf1 completely suppresses the Egl defect of sel-12 mutants. byDf1 derepresses the transcription of hop-1 in the early larval stages. byDf1 is a deletion of 31,069 bases from position 3052 of cosmid F46H6 to position 6698 of cosmid C07A12 with a single A base pair insertion. byDf1 deletes F46H6.2/dgk-2, F46H6.4, F46H6.1/rhi-1, C07A12.5/spr-3 and part of C07A12.7. byDf1 is null for spr-3 by sequence and northern analysis. Deletion can be detected with the primers RB1222 CTT ACT AGT ACT AGC TCG CG and RB1224 CCT GTC CAT AAG TGC AGT CC, which give a product of 1540 bp. This strain may not be used for commercial purposes.

Heterozygotes are WT and segregate WT, Paralyzed Uncs and L3 lethals. ua1 is a deletion of the first 3 full exons of the NADH-ubiquinone oxidoreductase of complex I in the mitochondrial respiratory chain.

Animals with the duplication are WT. Animals which have lost the duplication arrest at 3rd larval stage with increased life span. ua2 is a deletion of the first 2 exons of atp-2. atp-2 gene encodes for active site subunit of Complex V of mitochondrial respiratory chain, the ATP synthase.

Heterozygotes are WT and segregate WT, Dpy(ts) Steriles and Uncs which arrest in the L3 larval stage. ua2 is a deletion of the first 2 exons of atp-2. atp-2 gene encodes for active site subunit of Complex V of mitochondrial respiratory chain, the ATP synthase.

T21C9.2, F32G8.6. Serotonin-deficient by anti-serotonin staining. Bleach hypersensitive. Likely also dopamine-deficient (but not tested). Slightly sickly. External left primer: TTTCTTTTCTTGTTGCGCCT. External right primer: TCGAAAAAGTCTGCTTCGGT. Internal left primer: CGTCTTCCGTTTCTTTTTCG. Internal right primer: TCTTGGAATGTGGGATGTGA. Internal WT amplicon: 2497 bp. Deletion size: 2238 bp. Deletion left flank: CGACTAGATTGATTTCCTTCTGTCCCTTCA. Deletion right flank: CTTGACGGAACAACGCCTCGATCTGATCTC. This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. URL: http://www.celeganskoconsortium.omrf.org.

Serotonin and dopamine-deficient, bleach hypersensitive, general chemical hypersensitivity, fragile cuticle. 652 bp deletion removes entire first exon. Derived by outcrossing FX773 five times to N2.

Dpy. AQR and PQR migration defects. Body wall muscle defects. etr-1(lq133) is 2 bp deletion frameshift in alternatively-spliced exon 8. Reference: Ochs ME, et al. G3: Genes Genomes, Genetics. 2020 Jul 7;10(7):2365-2376. doi: 10.1534/g3.120.401182. PMID: 32398235

F53C11.8. Homozygous. Outer Left Sequence: AGGCGGAGAAAGTGACTTGA. Outer Right Sequence: CCCCTCACGCAGTGTTTTAT. Inner Left Sequence: TGAAGCAAATTGCAATCCAG. Inner Right Sequence: AACGAAATTGTGATCGGAGG. Inner Primer WT PCR Product: 2317. Deletion size: 1190 bp.

juIs76 [unc-25p::GFP + lin-15(+)] II. Precise deletion of src-1 generated by Cas9 genome editing. Balancer marked with myo-2p::Venus. Heterozygotes are wild-type with Venus+ pharynx, and will segregate wild-type with Venus+ pharynx (heterozygotes), sterile adults without Venus in pharynx (lq185 homozygotes), and Dpy with Venus+ pharynx (tmC20 homozygotes). GFP expression in GABAergic motor neurons. Reference: Mahadik S, et al. bioRxiv 2023.05.20.541322; doi: https://doi.org/10.1101/2023.05.20.541322.

Deletion in promoter region and 5' UTR.

C37E2.5 Deletion size 601 bp.

C37E2.5 Deletion size 786 bp.

T07E3.6 deletion mutant.

sma-4(jj278) worms are small, and the mutation can suppress the sma-9(0) loss of M-derived coelomocyte defect. sma-4(jj278) is a true molecular null allele of sma-4; the 3,556 bp deletion (position: Chromosome III: 5,816,203….5,819,759) removes almost the entire coding region of sma-4. Reference: McKillop AN, et al. (2018). A new deletion allele of sma-4. microPublication Biology. https://doi.org/10.17912/Z4Z9-CE10.

vs163 is a 169 bp deletion removing exon 2 and causing frameshift.

Very weak Egl. rgs-1=C05B7.7, a C. elegans RGS (Regulator of G protein Signaling) gene. nr2017 is a presumptive null allele. nr2017 is a 638 bp deletion of sequences whose limits are CGAGAAATTGTCAACACTAAC...GTTTGGAATGGTTTATCAGTT. The deleted material is replaced by the following 35 bp insertion: TATGTTTAAGTTAAGTTTATAGTTTAAGTTTAAAG.

rgs-2=F16H9.1, a C. elegans RGS (Regulator of G protein Signaling) gene. vs17 is a presumptive null allele. vs17 is a 1136 bp deletion of sequences with limits: ATATATATATCTCATTACTGG...AATCAAGTGTAACACTAATAT. rgs-1;rgs-2 double mutants fail to rapidly turn on egg-laying behavior when fed after starvation.

Healthy and appears grossly WT. This allele is a 1563 bp deletion of sequences AATTGAGTAGACAAC....GTGTCTTAAATAT. Removes almost all of the 2nd RGS domain. Previously known as cec-9.

Deletion removes 1465 bp. Removes start site and majority of RGS domain. Has beginning and end sequences AAAAAGATCGAATATCGGTTGT...TATGACGTAGCACAATATCAGG.

2446 bp deletion. Endpoints: CAAAGGGAAACTTCACGAGAAA...ATTGATTATTACTAACCAAAGT.

231 bp deletion removes all of exons 2 and 3 and throws the remaining portion of the proten (which contains the RGS domain) out of frame. Deletion endpoints are: GCAGCTCACGGAGCCCGGAGTT...CACCGTCGCCAAGACTTAGGTA.

This deletion removes most of exon1, all of exon 2, and most of exon 3. It removes a good chunk of the protein region, including the RGS domain.

167 bp deletion which takes out most of exon 3 and the first 42 bases of exon 4. The first 22 bp of the deletion are: TATGGCTGATATCCGCAGGAAT.

328 bp deletion which completely removes exons 8 and 9. The first 22 bp deleted are: cgttagtcccccttttaaaatt.

Heterozygotes are WT. Animals which have lost the duplication are Unc and homozygous for rgs-7. Animals which are homozygous for the duplication are dead. Unc is temperature sensitive. vs92 is a 361 bp deletion which removes the 3' splice site of exon 6, all of exon 7 and half of exon 8. All of the deleted region is within the RGS domain.

125 bp deletion. First 22 bp of deletion: AAGTATATTTTATTTTCAGGTA. Last 22 bp: GTGGCCATCATAGTTATGCCAT.

292 bp deletion. First 22 bp are: ACTTCCGTATTCCTTCTACTAC. Last 22 bp are: CTTAGCAGTTTCTGATTTTCTG.

This deletion removes sequence 5' to start of rgs-10 and may therefore remove promoter sequence for rgs-10&rgs-11.

Double mutants have reduced AWA gene expression. ok132 is a deletion and putative null allele. The boundaries of the deletion are: AGATTACTGATGCCATTGAACAAGTTCTCGTCA......TGATGTTTGAAAGGTGGAGT AGCAAAGAGA. ak47 is chemosensory, mechanosensory and osmosensory defective, and is a null allele.

Phenotypically WT. Deletion allele. A "T" is added also. The end points of the deletion are: TCGAACGTCAACAACATATTGCAAAT.....t.....TTGGAAAGGTAGGCTTACACTT TTTTTAA.