Search Strains

No obvious phenotype; partial effects on AiY interneuron differentiation; genotyped by PCR that covers the deletion in the ceh-23(ms23) allele.

CRISPR-engineered deletion in dmd-4(ot935[dmd-4::GFP]) removing +3201 to +3710 relative to start codon. Partial removal of intron 3 results in loss of somatic nervous system expression without affecting pharyngeal expression.

oyIs51 [srh-142::RFP]. ADF neurons are marked with RFP. sfGFP tag inserted at C-terminus of endogenous vap-1 locus. VAP-1::sfGFP can be used as a reporter for AMsh glia secretion. dgs-1(ns942) is a presumptive partial loss of function allele. dgs-1 loss of function causes VAP-1::sfGFP accumulation. Reference: Varandas KC, et al. Nat Commun. 2025 Jan 2;16(1):79. doi: 10.1038/s41467-024-55674-0. PMID: 39747235.

Defective in chemotaxis to all attractants except pyridine and D-tryptophan. Partial defects in taxis to pyridine, H+(phosphate) and H+(citrate).

ZK829.6. Homozygous. [NOTE: it has been reported that ok3107 disrupts the native locus, this strain appears to also carry at least a partial duplication of the tgt-1 locus.] Outer Left Sequence: GACATCCTACCGTTTCCTGG. Outer Right Sequence: CTCCTTTGCAACACGTACCA. Inner Left Sequence: TACGGTAGGCCCGATAATGA. Inner Right Sequence: CTTGGACATCGTCCCGGT. Inner Primer PCR Length: 1172 bp. Deletion Size: 684 bp. Deletion left flank: AAAAAAATTGTGTTCGAACGTTATTTTTAT. Deletion right flank: GTTGTCAATACATGAATTACATGATCCAAC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Severing and tagging of endogenous locus with trans-splicing ICR and GFP using CRISPR/Cas9. Pharynx and body muscles are green fluorescent and visible by dissection fluorescence microscopy. Severing is located upstream of kinase domain. Please contact Ryan Littlefield prior to publishing work using this strain.

Severing and tagging of endogenous unc-22 locus with trans-splicing ICR and GFP using CRISPR/Cas9. muIs252 [eft-3p::wrmScarlet1-10::unc-54 3'UTR + Cbr-unc-119(+)] II. Pharynx and body muscles are green and red fluorescent and visible by dissection fluorescence microscopy. Please contact Ryan Littlefield prior to publishing work using this strain.

Severing and tagging of endogenous unc-22 locus with trans-splicing ICR and GFP using CRISPR/Cas9. muIs257 [myo-3p::wrmScarlet1-10::unc-54 3'UTR] I. Pharynx and body muscles are green; red fluorescence only in body wall muscles. Please contact Ryan Littlefield prior to publishing work using this strain.

Made by PCR screen of Tc1 transposon insertion library. odc-1(pc13::Tc1) has a partial deletion of the Tc1 element. Phenotypically it has 35% reduction in brood size compared to the WT N2 Bristol strain.

rubSi6 [eft-3p::scFv(glo)::GFP(smu-1 introns)::tbb-2 3’UTR] II. rubSi7 [eft-3p::24xGCN4::T2A::tagBFP::H2B::tbb-2 3’UTR]) IV. SunTag system allows visualization of translation throughout development in real-time. This strain expresses a SunTag reporter mRNA (24xGCN4::T2A::tagBFP::H2B::tbb-2 3’UTR ) and a SunTag antibody (scFv::GFP). In the absence of translation, GFP signal can be observed in the cytoplasm, nuclei and at epithelial apical membranes. At translation sites of the SunTag reporter, clustering of the GFP signal can be observed. Mature GCN4 proteins can be observed as dimmer GFP clusters. rubSi6 was inserted into ttTi5605 and also includes a partial duplication of the transgene (a portion of GFP with smu-1 introns and tbb-2 3’UTR) downstream of the tbb-2 3’UTR in the intact transgene. rubSi7 was inserted into cxTi10816. Reference: van der Salm E, et al. Development. 2025 May 15;152(10):dev204435. doi: 10.1242/dev.204435. PMID: 40260543.

wrdSi23 [eft-3p::TIR1::F2A::mTagBFP2::AID*::NLS::tbb-2 3'UTR] (I:-5.32). rubSi6 [eft-3p::scFv(glo)::GFP(smu-1 introns)::tbb-2 3’UTR] II. rubSi8 [eft-3p::24xGCN4::AID::T2A::tagBFP::H2B::tbb-2 3’UTR *rubSi7]) IV. ltIs44 [pie-1p::mCherry::PH(PLC1delta1) + unc-119(+)] V. SunTag system allows visualization of translation throughout development in real-time. In the absence of translation, GFP signal can be observed in the cytoplasm, nuclei and at epithelial apical membranes. At translation sites of the SunTag reporter, bright clustering of the GFP signal can be observed. Mature GCN4 proteins can be observed as dimmer GFP clusters in the absence of auxin, but not in the presence of auxin. Bright BFP signal from mTagBFP2::AID*::NLS and TagBFP::H2B can be visible in nuclei in the absence of auxin, in the presence of auxin only dimmer TagBFP::H2B is visible in nuclei. mCherry::PH marks the cell membranes throughout development. rubSi6 was inserted into ttTi5605 and also includes a partial duplication of the transgene (a portion of GFP with smu-1 introns and tbb-2 3’UTR) downstream of the tbb-2 3’UTR in the intact transgene. rubSi8 derived by modification of insertion of an AID tag into rubSi7, which is located in cxTi10816. Reference: van der Salm E, et al. Development. 2025 May 15;152(10):dev204435. doi: 10.1242/dev.204435. PMID: 40260543.

This strain expresses a SunTag antibody (scFv::GFP) throughout development. GFP signal can be observed in the cytoplasm, nuclei and at epithelial apical membranes. rubSi6 [eft-3p::scfv(glo)::gfp(smu-1 introns)::tbb-2 3’UTR] was inserted into ttTi5605, and also includes a partial duplication of the transgene (a portion of GFP with smu-1 introns and tbb-2 3’UTR) downstream of the tbb-2 3’UTR in the intact transgene. Reference: van der Salm E, et al. Development. 2025 May 15;152(10):dev204435. doi: 10.1242/dev.204435. PMID: 40260543.

Mechanosensory abnormal (partial).

wyIs592 [ser-2(prom3)::myr::GFP + odr-1p::RFP] III. dma-1(wy908) is a partial loss of function allele generated by CRISPR/Cas9-induced frame shift with multiple premature stop codons (n=6, 8 bp deletion). Fluorescent PVD- and FLP-specific morphology markers. Reference: Shi R, et al. 2024 bioRxiv doi: https://doi.org/10.1101/2024.05.08.591205 PMID: 38766073.

leIs1 [pes-1::lacZ + rol-6(su1006)] V. Rollers. B-galactosidase expression begins in a subset of cells of the AB lineage which go on to produce muscle, nerve and hypodermal cells. B-galactosidase is also present within the D lineage until the cells move anteriorly to become body wall cells. Expression is also apparent in Z1 and Z4 which go on to form part of the somatic gonad. plasmid name: pUL#24C7. Plasmid backbone: pPD22.11. Partial Sau3A fragments cloned into BamH1 site of vector.

leIs6 [vha-8::lacZ + rol-6(su1006)]. Rollers. This strain shows B-galactosidase expression in the excretory cell and lateral nuclei of the hypodermis adjacent to the anterior and posterior branches of the excretory cell. The second component to this expression pattern appears to be localized in the hypodermis adjacent to the excretory canals. B-galactosidase was seen in the nuclei from late embryogenesis through to the adult. plasmid name: pUL#64A1. Partial Sau3A fragments cloned into BamH1 site of vector. Plasmid backbone: pPD22.11. A 2.7 Kb HindIII fragment from the insert of pUL#64A1 hybridized to YACs Y55E11, Y53F3, Y50C9, and Y73B6 which overlap on LGIV. References: Young JM, Hope IA. Dev Dyn. 1993 Feb;196(2):124-32. Hope IA, et al. Mol Gen Genet. 1998 Nov;260(2-3):300-8.

leIs8 [unc-5::lacZ + rol-6(su1006)]. Rollers. B-galactosidase expression was observed in the spermathecaeand the three rectal epithelial cells. Staining in the rectal area first observed in L1 larvae whilst expression in the spermathecae appeared as the structure formed in L4 larvae. Variable staining was also seen throughout the uterus. In the mature gonad staining appeared to be in two sets of two toroidal epithelial cells Ut-1 and Ut-2. Staining was also observed in the large H shpaed Use cell which attaches the uterus to the seam cells and the four epithelial cells Ut-1 and Ut-2. The Uv cells did not appear to stain. Individual worms often just showed one component of this expression. In males the expression was observed to be displayed in all or part of the procodeum. plasmid name: pUL#38E12. plasmid backbone: pPD22.11. Partial Sau3A fragments cloned into BamH1 site of vector.

Partial lethality on low B12 diet; supplemental vitamin B12 is helpful. Reference: Watson E, et al. Elife. 2016 Jul 6;5.

wIs51 [SCMp::GFP + unc-119(+)] V. GFP expression in seam cells. Retarded Heterochronic defects: extra seam cells and partial or no alae in young adults. hbl-1(ma430ma475) is a CRISPR/Cas9-edited allele, which contains a linker and the mScarlet-I sequence integrated in-frame with hbl-1 and part of the 3' UTR removed. Reference: Ilbay O & Ambros V. Development. 2019 Nov 6;146(21).

ruIs38 [myo-2p(partial)::GFP + unc-119(+)] III. Derived by out-crossing AZ218 eleven times to N2.

Maintain at 20C or lower. The cec-4 cec-5 double mutant exhibits partial sterility and no significant defects in chromosome segregation. The chromodomain proteins CEC-4 and CEC-5 are phylogenetically similar to CEC-8. ok3124 is a 374-bp deletion located in the region of the gene corresponding to the N-terminus of CEC-4 (F32E10.2). The ok3124 deletion can be detected by PCR with the following primers: CAATTAAAATGCCAGTGCGA and TTTAGGATGCATTATGGGGC. fj58 is a 398-bp deletion located in the gene region corresponding to the N-terminus of CEC-5 (F32E10.6). The fj58 deletion can be detected by PCR with the following primers: GCAAAGAAATCATCCGGTAGTG and CTTTGTAGCAACAGGCTCCTC. Reference: Tabara H, et al. (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002.

Maintain at 20C or lower. Him. cec-4 cec-5 him-8 triple mutants exhibit partial sterility. The intensity of histone H3K9me2 on meiotic chromosomes is reduced. ok3124 deletion can be detceted by PCR with the following primers: CAATTAAAATGCCAGTGCGA and TTTAGGATGCATTATGGGGC. fj61 is a 444-bp deletion located in the region of the gene corresponding to the N-terminus of CEC-5 (F32E10.6). The fj61 deletion can be detected by PCR with the following primers: GCAAAGAAATCATCCGGTAGTG and CTTTGTAGCAACAGGCTCCTC. Reference: Tabara H, et al. (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002.

Maintain at 20C or lower. cec-8; cec-4 cec-5 triple mutants exhibit partial sterility and no significant defects in chromosome segregation. The chromodomain proteins CEC-5, CEC-4, and CEC-8 are phylogenetically similar to each other. The deletions can be detected by PCR with the following primers: cec-8(fj63): GCTGTATAATACTCACTATGTC and TCCAGCTCTGTAACCTTGAA; cec-4(ok3124): CAATTAAAATGCCAGTGCGA and TTTAGGATGCATTATGGGGC; cec-5(fj58): GCAAAGAAATCATCCGGTAGTG and CTTTGTAGCAACAGGCTCCTC. Reference: Tabara H, et al. (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002.

Maintain at 20C or lower. Him. The cec-8; cec-4 cec-5 him-8 quadruple mutant exhibits partial sterility. The intensity of histone H3K9me2 on meiotic chromosomes is reduced. The deletions can be detected by PCR with the following primers: cec-8(fj63): GCTGTATAATACTCACTATGTC and TCCAGCTCTGTAACCTTGAA; cec-4(ok3124): CAATTAAAATGCCAGTGCGA and TTTAGGATGCATTATGGGGC; cec-5(fj58): GCAAAGAAATCATCCGGTAGTG and CTTTGTAGCAACAGGCTCCTC. Reference: Tabara H, et al. (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002.

Maintain at 20C or lower. The met-2 set-25 double mutant exhibits partial sterility and no significant defects in chromosome segregation. MET-2 and SET-25 are the methyltransferases responsible for histone H3K9me2 and H3K9me3. The deletion mutations can be checked by PCR with the following primers: met-2(ok2307), GGTTGATGCGGAGAAGACTG and AATGGATTCGGTGCTTCGTG; set-25(n5021), GAGCCCGTGCCACAGAGTAG and CCTAGAGCGATGTCCTTGATGG. This strain was used as a negative control in the immunodetection of H3K9me2.

mfIs42 [Cel-sid-2(+) + Cel-myo-2::dsRed]. Maintain at 15C. Feminization is partially-penetrant at 15C; most hermaphrodites are somewhat self-fertile and can lay small broods. Can be maintained by crossing with male siblings. Feminized C. briggsae strain made susceptible to RNAi knock-down by feeding dsRNA due to the transgenic expression of C. elegans SID-2. Generated by crossing parental strains JU1018 with RE665. Reference: Booth LN, eLife 2019 Jul 8;8:e46418. PMID: 31282863.

Temperature sensitive. Fertile at 16C. Partially fertile at 20C. Sterile at 25C. Spermatogenesis arrests at the spermatocyte stage.

Temperature-sensitive. Maintain at 15C. Fertile at 15C. Partially fertile at 20C. Sterile at 25C. Spermatogenesis arrests at the spermatocyte stage. Increase lifespan in males and hermaphrodites.

Temperature sensitive. Partially fertile at 16C (very few progeny). Sterile at 20C and 25C. Weak Dpy at 15C. Spermatogenesis arrests at the spermatocyte stage.

Heterozygotes are WT and segregate wild-type, wild-type heterozygotes, and Sterile Dpy (spe-4 dpy-20 homozygotes). Homozygous mutants are weak Dpy and partially fertile at 15C. Sterile at 20-25C. Spermatogenesis arrests at the spermatocyte stage.

Temperature-sensitive. Fertile at 15C. Partially fertile at 20C. Sterile at 25C. Twitcher. Spermatogenesis arrests at the spermatocyte stage.

Temperature-sensitive. Fertile at 15C. Partially fertile at 20C. Sterile at 25C. Spermatogenesis arrests at the spermatocyte stage.

Temperature-sensitive. Fertile at 15C. Partially fertile at 20C. Sterile at 25C. Twitcher. Spermatogenesis arrests at the spermatocyte stage.

Temperature-sensitive. Fertile at 15C. Partially fertile at 20C. Sterile at 25C. Spermatogenesis arrests at the spermatocyte stage.

Temperature-sensitive. Fertile and weak Dpy at 15C. Partially fertile at 20C. Sterile at 25C. Twitcher. Spermatogenesis arrests at the spermatocyte stage.

Endogenous erm-1 locus tagged with eGFP. Homozygous viable, partially functional endogenous erm-1 tag. erm-1::GFP animals have a reduced brood size and incomplete outgrowth of the excretory canal, but show no other developmental or morphological abnormalities.

hyEx23 [des-2p::eff-1 + des-2::GFP + rol-6(su1006)]. Cell-specific expression of eff-1 in the PVDs. Partially rescues arborization Eff-1 phenotypes. Pick GFP+ Rollers to maintain. Reference: Oren-Suissa M, et al. Science. 2010 Jun 4;328(5983):1285-8.

A 1.2 kb deletion in aff-1 (C44B7.3) which introduce stop codon after alanine 47. AFF-1 is a type I membrane protein necessary and sufficient for specific cell fusion events during embryonic and larval development. Temperature sensitivity was not detected. At 20° the fusion of hyp5 in the embryo does not occur as well as anchor cell (AC) fusion, vulval cells fusion of the A and D rings and the terminal fusion between the seam cells late in L4. 6% L1 rod-like lethal and 0% embryonic lethal. Adults are completely Egl, and partially Unc, Pvl. In addition, only 2% of AC in the mutant worms undergo fusion. These animals give very low brood size (16 progeny per worm) and 3.4% of the worms are sterile. This strain gives very small brood size and hence grows slowly. Originally from Shohei Mitani, Tokyo Women's Medical College, Tokyo, Japan.

Dpy. Movement Slow. Unc partially suppressed.

Movement slow. Unc partially suppressed.

Movement slow. Unc partially suppressed.

Dpy. Movement Slow. Unc partially suppressed.

Dumpy (partially-suppressed Dpy-31). Sqt-3 mediated suppression of dpy-31 lethality. Reference: Novelli et al. (2004) PMID: 15579684.

muEx158 [daf-16cAM::GFP + sur-5p::GFP] (AM = AKT-site mutant). Pick GFP+ worms to maintain. Sterile at 25C; grow at 20C or less. muEx158 contains GFP-tagged daf-16 c isoform (described as a1 isoform in Lin, et al. Nat Genet. 2001) with 4 Ser/Thr residues mutated to Ala, which completely rescues dauer formation and partially restores longevity of daf-16; daf-2 double mutants. Reference: Lin K, et al. Nat Genet. 2001 Jun;28(2):139-45.

muEx158 [daf-16cAM::GFP + sur-5p::GFP] (AM = AKT-site mutant). Pick GFP+ worms to maintain. Sterile at 25C; grow at 20C or less. muEx158 contains GFP-tagged daf-16 c isoform (described as a1 isoform in Lin, et al. Nat Genet. 2001) with 4 Ser/Thr residues mutated to Ala, which rescues daf-16 mutants from defective dauer formation and also partially rescues longevity defect of daf-16; glp-1 double mutants. Reference: Berman JR, & Kenyon C. Cell. 2006 Mar 10;124(5):1055-68.

Homozygous viable and fertile. Partially penetrant Egl and cell/axon guidance defects. Deletion of nucleotides 22756-24758 based on cosmid F39H11 sequence (Genbank AF164959). Results in loss of carboxyl NC1 domain from CLE-1.

bvIs2 contains [ric-19p::age-1(cDNA)::myc::unc-54 3'UTR + mec-7::GFP]. sqt-1(sc13) causes recessive left-handed rollers. bvIs2 rescues mg44 dauer arrest and partially rescues mg44 longevity. Array can be detected by PCR (Fwd: 5'-GCA CAG TTT TAC GAA AGG AAC-3' / Rev: 5'-ACC ATC GTT TGC AGT TGT GG-3'). Reference: Iser WB, Gami MS, Wolkow CA. Dev Biol. 2007 Mar 15;303(2):434-47.

bvIs1 contains [ges-1p::age-1(cDNA)::unc-54 3'UTR + mec-7::GFP]. sqt-1(sc13) causes recessive left-handed rollers. bvIs1 rescues mg44 dauer arrest and partially rescues mg44 longevity. Array can be detected by PCR (Fwd: 5'-GTC ATT TTG GCA CCA TAG GAG-3' / Rev: 5'-ACC ATC GTT TGC AGT TGT GG-3'). Reference: Iser WB, Gami MS, Wolkow CA. Dev Biol. 2007 Mar 15;303(2):434-47.

juSi83 [GFP::rps-18 + Cbr-unc-119(+)] II. Homozygous lethal mutation balanced by GFP-marked translocation. Heterozygotes are WT GFP+ and segregate WT GFP+, Vul and dead eggs. Non-conditonal GFP-tagged ribosomes; array over-expressing N-terminally tagged rps-18 (small ribosomal subunit) partially rescues rps-18(ok3353) larval arrest (some animals will escape L1 arrest and develop to L3 stage). Reference: Noma et al Elife. 2017 Aug 2;6. pii: e26376. doi: 10.7554/eLife.26376.

nsIs105 [hlh-17p::GFP] I. wyIs45 [ttx-3p::GFP::rab-3 + unc-122p::RFP] X. olaEx805 [hlh-17p::caspase12 + hlh-17p::caspase17 + ttx-3p::mCherry + glr-3p::mCherry + unc-122p::GFP]. Maintain by picking animals with GFP expression in coelomocytes. Ablation of CEPsh glia partially suppresses AIY presynaptic maintenance defects in cima-1(wy84) mutants. nsIs105 (hlh-17::GFP) expression labels CEPsh glia. Reference: Shao Z, et al. Cell. 2013 Jul 18;154(2):337-50.