More Fields
Strain Species Genotype
CZ18018 C. elegans juSi94 II; rps-18(ok3353) IV; juEx5375. Show Description
juSi94 [rps-18p::GFP11::rps-18 + Cbr-unc-119(+)] II. juEx5375 [col-19p::GFP(1-10) + ttx-3p::RFP]. Pick RFP+ to maintain. Expression of split GFP reporter labels ribosomes in the epidermis. Reference: Noma K, et al. Elife. 2017 Aug 2;6:e26376. doi: 10.7554/eLife.26376.
CZ19299 C. elegans juSi94 juIs438 II; rps-18(ok3353) IV. Show Description
juIs438 [mec-4p::GFP(1-10) + mec-4p::tagRFP] II. juSi94 [rps-18p::GFP11::rps-18]. Expression of split GFP reporter labels ribosomes in touch neurons. Generated in N2 background. Reference: Noma et al Elife. 2017 Aug 2;6. pii: e26376. doi: 10.7554/eLife.26376.
CZ17515 C. elegans juSi94 II; rps-18(ok3353) IV. Show Description
juSi94 [GFP11::rps-18 + Cbr-unc-119(+)] II. Superficially wild-type. No fluorescence; carries only one portion of a split GFP reporter for visualization of ribosomes. Allows inducible GFP fluorescence of ribosomes when combined with GFP1-10 expression in tissue of choice. Reference: Noma et al Elife. 2017 Aug 2;6. pii: e26376. doi: 10.7554/eLife.26376.
CZ18020 C. elegans juSi94 II; rps-18(ok3353) IV; juEx5377. Show Description
juSi94 [GFP11::rps-18 + Cbr-unc-119(+)] II. juEx5377 [myo-3p::GFP1-10 + ttx-3p::RFP]. Pick ttx-3::RFP to maintain. Muscle-specific expression of split GFP reporter allows visualization of ribosomes in muscle. Reference: Noma et al Elife. 2017 Aug 2;6. pii: e26376. doi: 10.7554/eLife.26376.
CZ20132 C. elegans juSi94 II; rps-18(ok3353) IV; juIs463. Show Description
juSi94 [GFP11::rps-18 + Cbr-unc-119(+)] II. juIs463 [flp-13p::GFP1-10 + ttx-3p::RFP]. DD motor neuron-specific expression of split GFP reporter allows visualization of ribosomes in those neurons. Reference: Noma et al Elife. 2017 Aug 2;6. pii: e26376. doi: 10.7554/eLife.26376.
CZ19297 C. elegans juSi94 II; rps-18(ok3353) juIs409 IV. Show Description
juSi94 [GFP11::rps-18 + Cbr-unc-119(+)] II. juIs409 [rgef-1p::GFP1-10 + ttx-3p::RFP] IV. Pan-neuronal-specific expression of split GFP reporter allows visualization of ribosomes in neurons. Reference: Noma et al Elife. 2017 Aug 2;6. pii: e26376. doi: 10.7554/eLife.26376.
VC2638 C. elegans rps-18(ok3353) IV/nT1 [qIs51] (IV;V). Show Description
Y57G11C.16. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok3353 homozygotes (probable embryonic arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TCCTTTCGTCTCTCTTCGGA. External right primer: GGCAACACTCATGCTTCTCA. Internal left primer: TGGCTTTTTCCGTTGAAACT. Internal right primer: CTTGGACAGGAAGGTGTTGG. Internal WT amplicon: 1340 bp. Deletion size: 442 bp. Deletion left flank: GCATCTCACTAAATTTTTTATTTTTCAGGG. Deletion right flank: GCCACCCAGTTTAATTATTTTGAGAGTAGC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
CZ18637 C. elegans juSi83 II; rps-18(ok3353) IV/nT1[qIs51] (IV;V). Show Description
juSi83 [GFP::rps-18 + Cbr-unc-119(+)] II. Homozygous lethal mutation balanced by GFP-marked translocation. Heterozygotes are WT GFP+ and segregate WT GFP+, Vul and dead eggs. Non-conditonal GFP-tagged ribosomes; array over-expressing N-terminally tagged rps-18 (small ribosomal subunit) partially rescues rps-18(ok3353) larval arrest (some animals will escape L1 arrest and develop to L3 stage). Reference: Noma et al Elife. 2017 Aug 2;6. pii: e26376. doi: 10.7554/eLife.26376.
CZ18412 C. elegans juSi94 II; rps-18(ok3353) IV; glo-4(ok623) V; juEx5515. Show Description
juSi94 [GFP11::rps-18 + Cbr-unc-119(+)] II. juEx5515 [unc-25p::GFP1-10 + unc-25p::mCherry::rab-3 + ttx-3p::RFP]. Pick ttx-3::RFP to maintain. GABAergic motor neuron-specific expression of split GFP reporter allows visualization of ribosomes in neurons, and GABAergic motor neuron-specific expression of mCherry::rab-3. Reference: Noma et al Elife. 2017 Aug 2;6. pii: e26376. doi: 10.7554/eLife.26376.
VC4445 C. elegans mrps-18C(gk5520[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ III. Show Description
Homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 1322 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: GAGGTCGCAGAAGAACATTGACCCCAGCTC; Right flanking sequence: GAAGAGATAAAACGAAAGCTAAGATTGCAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.