Strain Information
Name | ZT29 View On Wormbase |
---|---|
Species | C. elegans |
Genotype | cec-4(ok3124) cec-5(fj58) IV. |
Description | Maintain at 20C or lower. The cec-4 cec-5 double mutant exhibits partial sterility and no significant defects in chromosome segregation. The chromodomain proteins CEC-4 and CEC-5 are phylogenetically similar to CEC-8. ok3124 is a 374-bp deletion located in the region of the gene corresponding to the N-terminus of CEC-4 (F32E10.2). The ok3124 deletion can be detected by PCR with the following primers: CAATTAAAATGCCAGTGCGA and TTTAGGATGCATTATGGGGC. fj58 is a 398-bp deletion located in the gene region corresponding to the N-terminus of CEC-5 (F32E10.6). The fj58 deletion can be detected by PCR with the following primers: GCAAAGAAATCATCCGGTAGTG and CTTTGTAGCAACAGGCTCCTC. Reference: Tabara H, et al. (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002. |
Mutagen | Crispr/Cas9 |
Outcrossed | x1 |
Made by | Hiroaki Tabara |
Laboratory | YK |
Reference | Tabara H, Mitani S, Mochizuki M, Kohara Y, Nagata K (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002. |
Sign in
or
register an account if you want to order this strain.