Strain Information
Name | ZT34 View On Wormbase |
---|---|
Species | C. elegans |
Genotype | cec-8(fj63) III; cec-4(ok3124) cec-5(fj58) IV. |
Description | Maintain at 20C or lower. cec-8; cec-4 cec-5 triple mutants exhibit partial sterility and no significant defects in chromosome segregation. The chromodomain proteins CEC-5, CEC-4, and CEC-8 are phylogenetically similar to each other. The deletions can be detected by PCR with the following primers: cec-8(fj63): GCTGTATAATACTCACTATGTC and TCCAGCTCTGTAACCTTGAA; cec-4(ok3124): CAATTAAAATGCCAGTGCGA and TTTAGGATGCATTATGGGGC; cec-5(fj58): GCAAAGAAATCATCCGGTAGTG and CTTTGTAGCAACAGGCTCCTC. Reference: Tabara H, et al. (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002. |
Mutagen | Crispr/Cas9 |
Outcrossed | x1 |
Made by | Hiroaki Tabara |
Laboratory | YK |
Reference | Tabara H, Mitani S, Mochizuki M, Kohara Y, Nagata K (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002. |
Sign in
or
register an account if you want to order this strain.