Search Strains

oyIs51 [srh-142::RFP]. ADF neurons are marked with RFP. sfGFP tag inserted at C-terminus of endogenous vap-1 locus. VAP-1::sfGFP can be used as a reporter for AMsh glia secretion. fig-1(syb6983) is an engineered deletion removing teh fig-1 coding sequence. fig-1 loss of function causes VAP-1::sfGFP accumulation and dye filling defects. Reference: Varandas KC, et al. Nat Commun. 2025 Jan 2;16(1):79. doi: 10.1038/s41467-024-55674-0. PMID: 39747235.

Complete knock out of gene. Increased L1 arrest sleep/quiescence. Reference: Konietzka et al. 2019. Current Biology (accepted).

CRISPR/Cas9-engineered deletion of Lectin domain within endogenously-tagged LAT-1A. Internal eGFP and FLAG tags with poly-A linkers inserted into endogenous lat-1 locus before 651 aa. Reduced brood size and high levels of embryonic and larval lethality. Reference: Carmona-Rosas G, et al. bioRxiv 2023.05.04.539414; doi: https://doi.org/10.1101/2023.05.04.539414.

ccIs55 [unc-54::lacZ + sup-7(st5)] V. Unc lethal at 25C. Difficult to score <25C.

ccIs55 [unc-54::lacZ + sup-7(st5)] V. sy96 appears to suppress the Clr phenotype of e1745. Lots of Bags and larval lethals.

ccIs55 [unc-54::lacZ + sup-7(st5)] V. njEx38 [unc-54p::daf-2(+) + goa-1p::GFP + rol-6(su1006)]. Rollers. Pick Rollers to maintain. unc-43 gain-of-function suppressed; not markedly small. Egl-d. Lethal @ 25C; short L1's do not survive. No GFP expression.

utsIs3 [rab-11.2p::YFP::unc-54 3'UTR]. Transcriptional reporter for rab-11.2 activation. YFP expression is low at baseline and activated in the intestine by lipid depletion. Reference: Watterson A, et al. Nature. 2022 May;605(7911):736-740. doi: 10.1038/s41586-022-04729-7. PMID: 35585236.

ap426 is a CRISPR-engineered 8 bp deletion in the ALG-2 isoform A exon 2 causing a frameshift that produces a heavily truncated protein. Reference: Aalto AP, et al. PLoS Genet. 2018 Jun 21;14(6):e1007379.

Completely deficient in Class C acetylcholinesterase activity. Behavior is completely normal.

Heterozygotes are Lon non-Unc. Df/Df is embryonic lethal. Maintain by picking single Lon non-Unc and check for dead embryos-->Lon non-Unc recombinants that have lost the Df arise frequently. Does not survive long periods of starvation-->survivors tend to be Lon non-Uncs without the Df. Do not distribute this strain; other labs should request it from the CGC.

syIs9 [pJMGoQL + (pMH86) dpy-20(+)]. Phenotype of dominant activated Go alpha is lethargic and egg-laying defective - phenotype increases in severity as animal matures and ages. Animals frequently wander to the side of the plate. Animals move with decreased amplitude of sinusoidal waves. Dpy and WT revertants are frequent. Linkage unknown. Do not distribute this strain; other labs should request it from the CGC.

syIs12 [hsp::lin-3 + dpy-20(+)]. "low dose" overexpressor of the EGF repeat of lin-3 under control of the heat shock promoter. Wild type vulval differentiation when grown at 20C. Muv phenotype resulting from heat shock at L2 lethargis. Reference: Katz WS, et al. Cell. 1995 Jul 28;82(2):297-307. Do not distribute this strain; other labs should request it from the CGC.

Pale, scrawny appearance, probably due to starvation. Hyperactive, backs frequently, egg laying constitutive, slow pharyngeal pumping. Probably null (based on sequence, S. Nurrish). Suppresses activated GOA-1 and partially suppresses egl-3(rf). Lethal in combination with eat-16(rf). Previously called sag-1. Do not distribute this strain; other labs should request it from the CGC.

Vulvaless. 90% of the progeny are larval lethal-most die as L1s. Males are mating defective. Do not distribute this strain; other labs should request it from the CGC.

syIs129 [hemicentin(delta SP)::GFP + unc-119(+)]. Integrant of hemicentin::GFP reporter where the signal has been deleted. Do not distribute this strain; other labs should request it from the CGC.

flp-34(sy810) is a CRISPR/Cas9-engineered 1,365-bp deletion flanked by the sequences TCAAATTTTTTGAGGAAATCCTCCTGAAAC and AATATTTTCGAGTTTCGAAACATTTCAAAT with a AATATATTTTCGAGTTTCGAAACATATTTTCGAGTTTCGAAACAC insertion. Reference: Lee JS, et al. Proc Natl Acad Sci USA. 2017 Dec 12;114(50):E10726-E10735. PMID: 29167374

Superficially wild-type. a weak allele for C53C9.2 ; 58 bp insertion from downstream sequence of its own and 1 bp deletion (leading to change of an animo acid and insertion of 19 amino acids in frame); balanced with FX30326, further confimed by genotyping for homozygotes of C53C9.2 Left flanking sequence ACCGCTGTCGGTATGCCACGTTGGAATATCACCAAG; Right flanking sequence: ACAAGAAGCAAGGATACATCGCTCCAGATCAGAGATCTG; inserted sequence between the two flanking sequence: CTCGGAGAAGACATTCTCCGACGAGGAACCGAATTCACACCATGGTACTCTGGACAAA. sgRNA : GTATCCTTGCTTCTTGTCCT Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616

Superficially wild-type. CRISPR/Cas9 STOP-IN null mutant of C53C9.2. lethal strain balanced with tmC30[ubc-17(tmIs1243)] X (from parental strain FX30236; dominant red pharynx and recessive Lon Mec); this strain segregates wild type, long animals, and L1 arrested homozygotes. Pick wild-type animals to maintain the heterozygotes. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CGCTGTCGGTATGCCACGTTGGAATATCACCAAGG; right flanking sequence: ACAAGAAGCAAGGATACATCGCTCCAGATCAGAGATC; inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc Reference: Wang H, et al. G3 (Bethesda).

Heterozygotes are WT and segregate embryonic lethals (sy216 homozygotes) and paralyzed Uncs (h1040 homozygotes). sy216 is a deletion of the unc-101 gene region. Do not distribute this strain; other labs should request it from the CGC.

Superficially wild type. Penetrance lethal with lots of unhatched eggs and slow growth. CRISPR/Cas9 engineered STOP-IN null mutant of hint-3 into hint-1(sy1567) stop-in mutant. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: catgttttacaggATGACGTCAATGCATACTTCTGT. Right flanking sequence: TAACGGATGCAAGTTTTGTGACATTGTCAAAAATA. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TCAATGCATACTTCTGTTAA. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.

Male leaving assay defective (Las), lethargic, hypereversal. Reference: Barrios, A, et al. Nat Neurosci. 2012 Dec;15(12):1675-82.

cil-7(tm5848) is an out-of-frame deletion. Him. Reference: Maguire JE, et al. Mol Biol Cell. 2015 Aug 1;26(15):2823-32. doi: 10.1091/mbc.E15-01-0009. Epub 2015 Jun 3. PMID: 26041936.

cil-7(tm5848) is an out-of-frame deletion. Him. Reference: Maguire JE, et al. Mol Biol Cell. 2015 Aug 1;26(15):2823-32. doi: 10.1091/mbc.E15-01-0009. Epub 2015 Jun 3. PMID: 26041936.

Males are response and location-of-vulva defective. pkd-2(sy606) is a 2396 bp deletion (8388 to 5942 in YAC Y73F8A); mutant protein is predicted to contain the N-terminal portion of the protein midway through the first predicted transmembrane region.

fxSi3 [hsp-16.41p::PEEL-1::tbb-2 3' UTR + rpl-28p::mKate2::unc-54 3'UTR + rps-0p::HygR::unc-54 3' UTR, I:2851003] I. fxSi4 [hsp-16.41p::PEEL-1::tbb-2 3'UTR + loxP, II: 8420157] II. Heat-shock strain can be maintained at 20C without any issues. Degron tag was inserted into the endogenous spe-44 locus, allowing auxin-inducible spermatogenesis arrest and reversible male sterility. Heat-shock-induced expression of PEEL-1 will cause lethality in both sexes. Five generations of lab adaptation following genome editing, all in the CB4856 background. Reference: Kasimatis, KR et al. (2021) Post-Insemination Selection Dominates Pre-Insemination Selection in Driving Male Competitive Ability. bioRxiv doi: https://doi.org/10.1101/2021.06.23.449605

fxSi1 [pie-1p::TIR-1::mRuby::unc-54 3' UTR + loxP, I: 2851003] I. fxSi4 [hsp-16.41p::PEEL-1::tbb-2 3'UTR + loxP, II: 8420157] II. fxSi6 [hsp-16.41p::PEEL-1::tbb-2 3' UTR + rpl-28p::mKate2::unc-54 3'UTR + rps-0p::HygR::unc-54 3' UTR, III: 10158855] III. Heat-shock strain can be maintained at 20C without any issues. Degron tag was inserted into the endogenous spe-44 locus, allowing auxin-inducible spermatogenesis arrest and reversible male sterility. Heat-shock-induced expression of PEEL-1 will cause lethality in both sexes. fxSi4 was originally inserted in a CB4845 background, but has been sufficiently backcrossed so that PX658 is >98.5% JU2526 genetic background. Reference: Kasimatis, KR. et al. (2021) Post-Insemination Selection Dominates Pre-Insemination Selection in Driving Male Competitive Ability. bioRxiv doi: https://doi.org/10.1101/2021.06.23.449605

fxIs10 [synthetic guide site::(delta)HygR::unc-54 3' UTR::LoxP, II:8420157]. fxIs10 is a CRISPR-engineered site for future transgene insertion via CRISPR utilizing a synthetic guide site (GGACAGTCCTGCCGAGGTGGAGG​) with a split hygromycin resistance selection marker; fxIs10 also introduced a small deletion of genomic sequence at the insertion site (II:8420158-8420207). Reference: Stevenson ZC, et al. G3 (Bethesda). 2020 Oct 5;10(10):3775-3782. doi: 10.1534/g3.120.401400. PMID: 32816924

fxSi8 [synthetic guide site1::3'(delta)HygR::unc-54 3' UTR::LoxN (I:2851003)]. fxSi8 is a CRISPR-engineered site in the N2 background for future transgene insertion via CRISPR utilizing a synthetic guide site (GTTTGAGTAGAGCACTCAGGAGG) with a split hygromycin resistance selection marker; fxSi8 also introduced a small deletion of genomic sequence at the insertion site (I:2851004-2851014).

fxSi9 [synthetic guide site1::3'(delta)HygR::unc-54 3' UTR::LoxN (I:2851003)]. fxSi9 is a CRISPR-engineered site in the MY16 background for future transgene insertion via CRISPR utilizing a synthetic guide site (GTTTGAGTAGAGCACTCAGGAGG) with a split hygromycin resistance selection marker; fxSi9 also introduced a small deletion of genomic sequence at the insertion site (I:2851004-2851014).

fxSi10 [synthetic guide site1::3'(delta)HygR::unc-54 3' UTR::LoxN (I:2851003)]. fxSi10 is a CRISPR-engineered site in the CB4856 background for future transgene insertion via CRISPR utilizing a synthetic guide site (GTTTGAGTAGAGCACTCAGGAGG) with a split hygromycin resistance selection marker; fxSi10 also introduced a small deletion of genomic sequence at the insertion site (I:2851004-2851014).

fxSi11 [synthetic guide site1::3'(delta)HygR::unc-54 3' UTR::LoxN (I:2851003)]. fxSi11 is a CRISPR-engineered site in the JU775 background for future transgene insertion via CRISPR utilizing a synthetic guide site (GTTTGAGTAGAGCACTCAGGAGG) with a split hygromycin resistance selection marker; fxSi11 also introduced a small deletion of genomic sequence at the insertion site (I:2851004-2851014).

fxSi13 [synthetic guide site1::3'(delta)HygR::unc-54 3' UTR::Lox2272 (III:10158855)]. fxSi13 is a CRISPR-engineered site in the N2 background for future transgene insertion via CRISPR utilizing a synthetic guide site (GTCCAGCGGCAGATCGGCGGAGG) with a split hygromycin resistance selection marker; fxSi13 also introduced a small deletion of genomic sequence at the insertion site (III:10158856-10158894).

ytEx209 contains [mel-46(+) + sur-5::GFP]. Maintain by picking GFP+. Culture at 20°C or higher in order not to lose the transgene. GFP minus worms are Mel or sterile at 25 C (completely penetrant). Strong but not fully penetrant Mel at 15 C. To start a yt5 homozygous culture transfer several GFP minus worms to 15°C.

ytEx211 contains [pRM8(mel-46+) + pTG96(sur-5::GFP)]. Larval lethal. GFP minus worms die or arrest as L4 larvae.

Superficially wild-type. paqr-1(tm3262) have an increased number of small lipid droplets when combined with paqr-2(tm3410) in double mutants. Reference: Svensson E, et al. PLoS One. 2011;6(6):e21343.

Increased lethality and male frequency. Synthetic lethal with helq-1(tm2134). Sensitive to camptothecin. Interacts with rip-1 and rfs-1. Reference: McClendon TB, et al. Genetics. 2016 May;203(1):133-45.

CRISPR/Cas9-engineered deletion of him-5. High incidence of males. Reference: Macaisne N, et al. Genetics (2018) 2010:843-856. PMID 30242011

Vulvaless due to the lin-7 allele. Non-null allele of agl-1; Gro and Diet/nutrition-dependent maternal effect embryonic lethal due. Reference: Simske JS, et al. (1999). Ventral enclosure in C. elegans: getting to the molecules presented in International C. elegans Meeting.

Gin is Glucose INtolerant. gin-1(cv10) is a Diet/nutrition-dependent maternal effect embryonic lethal. Lethality is significantly increased with growth on OP50 seeded on glucose supplemented plates. Grown on HB101, HT115 or fresh OP50 (seeded less than five days)

Mitani Laboratory allele. Gro, Maternal-effect, diet/nutrition-dependent embryonic lethal. Strain segregates near 100% lethality when grown on glucose, UV-treated OP50, older OP50, and DA837. Lethality is suppressed on fresh OP50 (less than 5 days from seeding), HB101, and HT115.

Maternal-effect, diet/nutrition-dependent embryonic lethal. Strain segregates increased embryonic lethality when grown on glucose, UV-treated OP50, older OP50, and DA837. Lethality is suppressed on fresh OP50 (less than 5 days from seeding), HB101, and HT115.

Gin is Glucose INtolerant. gin-2(cv11) is a Diet/nutrition-dependent maternal effect embryonic lethal. Lethality is significantly increased with growth on OP50 seeded on glucose supplemented plates. 20C, Grown on HB101, HT115 or fresh OP50 (seeded less than five days).

Large yolk platelets in oocytes. Premature yolk degradation in embryos. Large endosomes in coelomocytes and intestine. Reference: Chotard L, et al. Mol Biol Cell. 2010 Jul 1;21(13):2285-96.

Maintain at 15C.  Temperature-sensitive embryonic lethal with defects in embryonic cytokinesis.  Suppressor of the lin-2 Vul phenotype

vhIs12 [vha-6p::GFP::tbc-2 + Cbr-unc-119(+)] II.  vhIs12 is inserted to the left of tbc-2(m2241) in LG II. GFP::TBC-2 rescues the large endosome phenotype in the intestine of tbc-2(tm2241) animals. Outside the intestine, tbc-2(tm2241) animals have large yolk platelets in the oocytes and early embryos that are not rescued.

dvIs19 [(pAF15) gst-4p::GFP::NLS] III. Hypomorphic allele of skn-1 that may be propagated as a homozygote. High rate of embryonic lethality and slightly lower brood size compared to N2. Reference: Tang L, Dodd W, Choe K. G3 (Bethesda). 2015 Dec 29.

Hypomorphic allele of skn-1 that may be propagated as a homozygote. High rate of embryonic lethality and slightly lower brood size compared to N2. Reference: Tang L, Dodd W, Choe K. G3 (Bethesda). 2015 Dec 29.

tm442 is a 411 bp deletion and 13 bp insertion. Outcrossed to mC6g males. Reference: Large and Mathies (2010) Dev Biol 339(1):51-64.

tm1692 is a 656 bp deletion and 13 bp insertion. Outcrossed to mC6g males. Reference: Large and Mathies (2010) Dev Biol 339(1):51-64.

Heterozygotes are mostly wild-type but occasionally lack a gonad arm; segregate tm4567 homozygotes (larval/embryonic lethal) and rol-9 homozygotes (Rol). Pick non-Rol to maintain and screen for larval lethals (or by PCR) for tm4567 deletion. Reference: Large EE and Mathies LD (2014 Jan 8). G3, doi: 10.1534/g3.113.009852.