Search Strains

More Fields
Strain Species Genotype Add
EH487 C. elegans inx-3(lw68) X; lwEx27. Show Description
lwEx27 [inx-3::GFP]. inx-3(lw68) embryos display a wide range of developmental defects. All L1s that manage to hatch have a Pun (pharynx unattached) phenotype. inx-3::GFP transgene rescues lw68 to wild-type. Pick L2s or later to maintain. Reference: Starich, et al., 2003. Dev. Biol. 256:403.
EJ1158 C. elegans gon-2(q388) I. Show Description
NOTE: Supplement media to 50 mM Mg2+ and grow at 15C for maximum fertility. Temperature-sensitive failure of gonad precursor divisions. Penetrance of Gon phenotype is high at 23.5C. At 25 degrees you can expect reduced brood sizes and some embryonic lethality. [Note: temperature sensitive period for gon-2(q388) begins prior to fertilization.] Reference: Sun AY & Lambie EJ. Genetics. 1997 Nov;147(3):1077-89.
EJ1171 C. elegans gon-2(q388) I; gem-1(bc364) X. Show Description
NOTE: Supplement media to 50 mM Mg2+ and grow at 15C for maximum fertility. The stock will propagate on non-supplemented media at 20 degrees, but this will potentially select for intragenic revertants of gon-2(q388). Temperature-sensitive failure of gonad precursor divisions. Penetrance of Gon phenotype is very high at 23.5C. At 25 degrees you can expect reduced brood sizes and some embryonic lethality. [Note: temperature sensitive period for gon-2(q388) begins prior to fertilization.] bc364 deletes 1,109 bp between AACATCTTGAATAACCATTCGGGAAGT and AAGTCATTCATTGCAGAGCTTACATTTAGTA. References: Kemp BJ, et al. Genetics. 2009 Feb;181(2):581-91. Sun AY & Lambie EJ. Genetics. 1997 Nov;147(3):1077-89.
EJ374 C. elegans gon-2(dx22) fer-1(hc1) unc-29(e1072) I. Show Description
Unc. Temperature senstive for both gon-2 and fer-1. Maintain at 15C. Will also grow at 20C. Received new stock 10/12/00 from EJ.
EJ420 C. elegans gon-2(dx23) fer-1(hc1) I. Show Description
Temperature sensitive for both gon-2 and fer-1. Maintain at 15C. Will also grow at 20C.
EJ808 C. elegans gem-4(dx77) IV. Show Description
No apparent phenotype. Suppressor of gon-2(q388).
EK273 C. elegans hpk-1(pk1393) X. Show Description
Homozygous viable. Males do not mate (or mate poorly). Probable null allele.
EKM11 C. elegans htz-1(tm2469) IV/nT1 [qIs51] (IV;V). Show Description
Maintain under normal condition. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP tm2469 homozygotes (Sterile). tm2469 m+z- are sterile adults. Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Reference: Petty EL, et al. PLoS Genet. 2009 Oct;5(10):e1000699. doi: 10.1371/journal.pgen.1000699. Csankovszki G, et al. (2009) Curr Biol 19(1):9-19. [NOTE: new stock received at CGC 05/26/2021. Original stock received in 2010 had broken down and was no longer segregating as expected.]
EKM4 C. elegans capg-1(tm1514) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Homozygous sterile deletion balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP tm1514 homozygotes (sterile, tm1514 m+z- are larval lethal). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Reference: Csankovszki G, et al. (2009) Curr Biol 19(1):9-19.
EL477 C. elegans iffb-1(bc367)/sC1 [dpy-1(s2170)] III. Show Description
Heterozygotes are WT and segregate WT, Dpy sC1 homozygotes, and bc367 homozygotes which arrest as late L1/early L2 larvae (survive for a few days, then die).
EL488 C. elegans ekl-1(om83)/unc-15 ccIs4251 I. Show Description
Heterozygotes are superficially wildtype and express GFP in body wall muscle nuclei. They segregate sterile ekl-1(om83) homozygotes and unc-15(e73) ccIs4251 homozygotes that are severely uncoordinated and GFP+ in body wall muscle nuclei. Pick wild-type GFP+ and check for correct segregation of progeny. The ccIs4251 insertion carries [(pSAK2) myo-3p::GFP::LacZ::NLS + (pSAK4) myo-3p::mitochondrial GFP + dpy-20(+)]. Reference: She X, et al. PLoS Genet. 2009 Aug;5(8):e1000624. doi: 10.1371/journal.pgen.1000624. PMID: 19714217.
EL602 C. elegans cid-1&pup-2(om129)/qC1 [dpy-19(e1259) glp-1(q339)] nIs189 III. Show Description
Pick wild-type GFP+ to maintain. Heterozygotes are wild-type GFP+ (pharynx), and segregate wild-type GFP+ heterozygotes, Dpy Sterile GFP+, and non-GFP om129 homozygotes (reduced fertility, maternal effect embryonic lethality, and high incidence of male offspring). om129 homozygote defects become more severe over successive generations and are more severe at 25C. om129 is a CRISPR-engineered deletion completely removing cid-1 and pup-2 loci. cid-1 also known as pup-1. nIs189 [myo-2::GFP] integrated in or near qC1. No recombination seen between nIs189 and qC1; fails to complement all markers on qC1. Reference: Yang B, et al. PLoS Genet. 2019 Feb 22;15(2):e1007992. doi: 10.1371/journal.pgen.1007992. PMID: 30794539. Superficially wildtype strain expresses GFP in the pharynx and segregates GFP+ dumpy sterile qC1 homozygotes and homozygous pup-1/-2(om129) animals that have reduced fertility and maternal effect embryonic lethality and are Him. Phenotype becomes more severe over successive generations and is more severe at 25°C. Reference: Li Y, et al. Development. 2018 Oct 10;145(19):dev165944. doi: 10.1242/dev.165944. PMID: 30305273.
EL630 C. elegans smrc-1(om138)/qC1 [dpy-19(e1259) glp-1(q339)] nIs189 III. Show Description
Pick wild-type GFP+ to maintain. Heterozygotes are wild-type GFP+ (pharynx), and segregate wild-type GFP+ heterozygotes, Dpy Sterile GFP+, and non-GFP om138 homozygotes (reduced fertility, reduced embryonic viability and a high proportion of male offspring). om138 is a frameshift mutation. nIs189 [myo-2::GFP] integrated in or near qC1. No recombination seen between nIs189 and qC1; fails to complement all markers on qC1. Reference: Yang B, et al. PLoS Genet. 2019 Feb 22;15(2):e1007992. doi: 10.1371/journal.pgen.1007992. PMID: 30794539.
EL632 C. elegans smrc-1(om138) met-2(n4256)/qC1 [dpy-19(e1259) glp-1(q339)] nIs189 III. Show Description
Pick wild-type GFP+ to maintain. Heterozygotes are wild-type GFP+ (pharynx), and segregate wild-type GFP+ heterozygotes, Dpy Sterile GFP+, and non-GFP non-GFP smrc-1(om138) met-2(n4256) homozygotes (reduced fertility, reduced embryonic lethality, and produce a high frequency of male offspring). These phenotypes are more severe at 25C, and at 25C the subsequent M-Z- generation produces essentially no viable embryos. The smrc-1(om138) allele was generated with CRISPR/Cas9 on the met-2(n4256) chromosome. nIs189 [myo-2::GFP] integrated in or near qC1. No recombination seen between nIs189 and qC1; fails to complement all markers on qC1. Reference: Yang B, et al. PLoS Genet. 2019 Feb 22;15(2):e1007992. doi: 10.1371/journal.pgen.1007992. PMID: 30794539.
EL658 C. elegans smrc-1(om138) met-2(om142[3xflag::met-2])/qC1 [dpy-19(e1259) glp-1(q339)] nIs189 III. Show Description
Pick wild-type GFP+ to maintain. Heterozygotes are wild-type GFP+ (pharynx), and segregate wild-type GFP+ heterozygotes, Dpy Sterile GFP+, and non-GFP smrc-1(om138) met-2(om142) homozygotes (reduced fertility, reduced embryonic viability and high incidence of male offspring). Defects are more prominent in M-Z- animals at 25C. 3xFlag tag inserted at N-terminus of endogenous met-2 locus using Crispr/Cas9. nIs189 [myo-2::GFP] integrated in or near qC1. No recombination seen between nIs189 and qC1; fails to complement all markers on qC1. Reference: Yang B, et al. PLoS Genet. 2019 Feb 22;15(2):e1007992. doi: 10.1371/journal.pgen.1007992. PMID: 30794539.
EL680 C. elegans smrc-1(q136)/qC1 [dpy-19(e1259) glp-1(q339)] nIs189 III. Show Description
Pick wild-type GFP+ to maintain. Heterozygotes are wild-type GFP+ (pharynx), and segregate wild-type GFP+ heterozygotes, Dpy Sterile GFP+, and non-GFP q136 homozygotes (reduced fertility, reduced embryonic viability, and increased frequency of male offspring). q136 is a nonsense mutation. nIs189 [myo-2::GFP] integrated in or near qC1. No recombination seen between nIs189 and qC1; fails to complement all markers on qC1. Reference: Yang B, et al. PLoS Genet. 2019 Feb 22;15(2):e1007992. doi: 10.1371/journal.pgen.1007992. PMID: 30794539.
EL69 C. elegans unc-32(e189) glp-1(q231) III; sog-3(q294) IV. Show Description
Unc. Fertile with viable progeny at or below 20C. Glp-1 sterile at higher temperatures. No obvious visible phenotype associated with sog-3.
EM435 Oscheius myriophilus Oscheius myriophilus wild isolate. Show Description
WT strain. Isolated by D. Fitch in June 1990 from soil in Scott Emmons' compost heap in the Fort Greene section of Brooklyn, NY. A second strain, DF5038, was isolated from the same location one year later from the head and ventral segments of a male pill bug (Armadillidium vulgare). Hermaphroditic. Males are easily isolated by heat shocking L4 or early adult hermaphrodites at 30C for 6-12 hrs. Grows well at 6-25C on OP50. Dauer larvae accumulate under starved or overcrowded conditions. Freezes easily using C. elegans protocols with 90% viability. Previously called Rhabditis sp. See also WBPaper00003418. Formerly known as Oscheius myriophila.
EM67 C. elegans mab-20(bx24) I; him-5(e1490) V. Show Description
Extensive ray fusion. Posterior portion of body swollen at larval stages.
ENL68 C. elegans sma-10(ok2224) zIs356 IV. Show Description
zIs356 [daf-16p::daf-16a/b::GFP + rol-6(su1006)]. See strain TJ356 for additional information about zIs356. Derived from RB1739 and TJ356.
ER10 C. elegans unc-123(jd5) III. Show Description
Temperature sensitive, semidominant mutant that is Unc when moving backward. Dorsal muscular contraction is stronger than that of ventral, resulting in an asymmetric pattern of locomotion in which the animal either forms a dorsal coil or moves in circles with the dorsal side central to the circle. Most likely a gain of function allele of sup-1.
ER50 C. elegans unc-123(jd5jd10) III. Show Description
Recessive suppressor of unc-123(jd5). Exhibits a subtle dorsal asymmetric locomotory defect as a homozygote when grown at 25C. Dominant suppressor of unc-17(e245). Most likely unc-123 is allelic with sup-1.
ERC103 C. elegans ieSi57 II; wapl-1(syb6035[wapl-1::GGGGS::AID*::emGFP]) IV. Show Description
ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. Single copy transgene inserted into chromosome II (oxTi179) expressing modified Arabidopsis thaliana TIR1 tagged with mRuby in the soma. AID* and emGFP tag inserted into endogenous smc-3 locus. Derived by crossing parental strains PHX6035 with CA1200. Reference: Cahoon CK, Libuda DE. Conditional immobilization for live imaging Caenorhabditis elegans using auxin-dependent protein depletion. G3 (Bethesda). 2021 Oct 19;11(11):jkab310. doi: 10.1093/g3journal/jkab310. PMID: 34534266; PMCID: PMC8527506.
ERC82 C. elegans ieSi57 II; ers54[dpy-27::AID*::GFP] III. Show Description
ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. AID*::GFP tag inserted into the endogenous dpy-27 locus. Dumpy, Him, X chromosome dosage compensation hypomorph. ieSi57 is a single-copy transgene insertion into chromosome II (oxTi179) expressing modified Arabidopsis thaliana TIR1 tagged with mRuby in the soma. This strain can be used for auxin-inducible degradation (AID) of target proteins in somatic tissues. Reference: Morao AK, et al. Mol Cell. 2022 Nov 17;82(22):4202-4217.e5. doi: 10.1016/j.molcel.2022.10.002. PMID: 36302374.
ERC83 C. elegans ieSi57 ers55[top-2::AID*::GFP] II. Show Description
ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. AID* tag inserted into the endogenous top-2 locus. ieSi57 is a single-copy transgene insertion into chromosome II (oxTi179) expressing modified Arabidopsis thaliana TIR1 tagged with mRuby in the soma. This strain can be used for auxin-inducible degradation (AID) of target proteins in somatic tissues. Reference: Morao AK, et al. Mol Cell. 2022 Nov 17;82(22):4202-4217.e5. doi: 10.1016/j.molcel.2022.10.002. PMID: 36302374.
ERC84 C. elegans top-1(ers56[top-1::AID*::GFP]) I; ieSi57 II. Show Description
ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. AID* tag inserted at the end of exon five in the endogenous top-1 locus. ieSi57 is a single-copy transgene insertion into chromosome II (oxTi179) expressing modified Arabidopsis thaliana TIR1 tagged with mRuby in the soma. This strain can be used for auxin-inducible degradation (AID) of target proteins in somatic tissues. Reference: Morao AK, et al. Mol Cell. 2022 Nov 17;82(22):4202-4217.e5. doi: 10.1016/j.molcel.2022.10.002. PMID: 36302374.
ERT16 C. elegans jyEx4. Show Description
jyEx4 [zip-2::GFP + myo-2p::mCherry]. Pick animals with mCherry+ pharynx to maintain. Array is stable; might have integrated. ZIP-2::GFP protein is only expressed in the intestine when animals are infected with pathogenic Pseudomonas aeruginosa strain (PA14) or when other processes (e.g. translation) are perturbed (see Dunbar TL, et al. for more information). Reference: Dunbar TL, et al. Cell Host Microbe. 2012 Apr 19;11(4):375-86.
ERT54 C. elegans jyIs8 X. Show Description
jyIs8 [pals-5p::GFP + myo-2p::mCherry] X. GFP expression induced in the intestine after intracellular infection or proteasomal inhibition. Reference: Bakowski MA, et al. PLoS Pathog. 2014 Jun 19;10(6):e1004200.
ESC332 C. elegans rpoa-2(cse319[AID*::GFP::rpoa-2]) I; ieSi57 II. Show Description
ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. Maintain at 15-20C. AID* and GFP tag inserted at the N-terminus of the endogenous rpoa-2 locus. This strain can be used for auxin-inducible degradation (AID) of RPOA-2 in somatic tissues. Reference: Zhao Q, et al. PLoS Biol. 2023 Aug 31;21(8):e3002276. doi: 10.1371/journal.pbio.3002276. PMID: 37651423.
ESC351 C. elegans rpoa-2(cse319[AID*::GFP::rpoa-2]) I; reSi2 II. Show Description
reSi2 [col-10p::TIR1::F2A::mTagBFP2::AID*::NLS::tbb-2 3'UTR] (II:0.77). Maintain at 15-20C. AID* and GFP tag inserted at the N-terminus of the endogenous rpoa-2 locus. This strain can be used for auxin-inducible degradation (AID) of RPOA-2 in hypodermis. Reference: Zhao Q, et al. PLoS Biol. 2023 Aug 31;21(8):e3002276. doi: 10.1371/journal.pbio.3002276. PMID: 37651423.
ESC352 C. elegans qzIs15[rpoa-2p::AID*::GFP::rpoa-2] I; ieSi60 II. Show Description
ieSi60 [myo-2p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. Maintain at 15-20C. AID* and GFP tag inserted at the N-terminus of the endogenous rpoa-2 locus. This strain can be used for auxin-inducible degradation (AID) of RPOA-2 in pharyngeal muscle. Reference: Zhao Q, et al. PLoS Biol. 2023 Aug 31;21(8):e3002276. doi: 10.1371/journal.pbio.3002276. PMID: 37651423.
ESC360 C. elegans rpoa-2(cse319[AID*::GFP::rpoa-2]) I; emcSi71 IV. Show Description
emcSi71 [myo-3p::TIR1::mRuby] (IV: -0.05). Maintain at 15-20C. AID* and GFP tag inserted at the N-terminus of the endogenous rpoa-2 locus. This strain can be used for auxin-inducible degradation (AID) of RPOA-2 in muscles. Reference: Zhao Q, et al. PLoS Biol. 2023 Aug 31;21(8):e3002276. doi: 10.1371/journal.pbio.3002276. PMID: 37651423.
ESC373 C. elegans rpoa-2(cse319[AID*::GFP::rpoa-2]) I; ieSi61 II. Show Description
ieSi61 [ges-1p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. Maintain at 15-20C. AID* and GFP tag inserted at the N-terminus of the endogenous rpoa-2 locus. This strain can be used for auxin-inducible degradation (AID) of RPOA-2 in the intestine. Reference: Zhao Q, et al. PLoS Biol. 2023 Aug 31;21(8):e3002276. doi: 10.1371/journal.pbio.3002276. PMID: 37651423.
ESC374 C. elegans rpoa-2(cse319[AID*::GFP::rpoa-2]) I; ieSi38 IV. Show Description
ieSi38 [sun-1p::TIR1::mRuby::sun-1 3'UTR + Cbr-unc-119(+)] IV. Maintain at 15-20C. AID* and GFP tag inserted at the N-terminus of the endogenous rpoa-2 locus. This strain can be used for auxin-inducible degradation (AID) of RPOA-2 in germ line and early embryos. Reference: Zhao Q, et al. PLoS Biol. 2023 Aug 31;21(8):e3002276. doi: 10.1371/journal.pbio.3002276. PMID: 37651423.
ESC440 C. elegans reSi2 II; tsr-2(cse424[tsr-2::degron::GFP]) IV. Show Description
Maintain at 15-20C. reSi2 [col-10p::TIR1::F2A::mTagBFP2::AID*::NLS::tbb-2 3'UTR] (II:0.77). Hypodermal-specific expression of TIR1 co-factor for AID. degron::GFP tag inserted into the C-terminus of endogenous tsr-2 locus. This strain can be used for auxin-inducible degradation (AID) of TSR-2 in epidermal tissues. Nucleolar GFP expression. Reference: Zhao Q., et al. PLoS Biol. 2023 Aug 31;21(8):e3002276. doi: 10.1371/journal.pbio.3002276. PMID: 37651423.
ESC444 C. elegans reSi2 II; grwd-1(cse432[grwd-1::degron::GFP]) III. Show Description
Maintain at 15-20C. reSi2 [col-10p::TIR1::F2A::mTagBFP2::AID*::NLS::tbb-2 3'UTR] (II:0.77). Hypodermal-specific expression of TIR1 co-factor for AID. degron::GFP tag inserted into the C-terminus of endogenous tsr-2 locus. This strain can be used for auxin-inducible degradation (AID) of GRWD-1 in epidermal tissues. Nuclear GFP expression. Reference: Zhao Q., et al. PLoS Biol. 2023 Aug 31;21(8):e3002276. doi: 10.1371/journal.pbio.3002276. PMID: 37651423.
ESC794 C. elegans wrdSi23 cse772 [AID*::GFP::rpoa-2] I; nucl-1(cse770[nucl-1::mKate2]) IV. Show Description
wrdSi23 [eft-3p::TIR1:F2A:mTagBFP::tbb2 3' UTR:: loxP] I. Maintain at 16-20C. AID*::GFP tag inserted at N terminus of endogenous rpoa-2 locus. mKate2 tag inserted into the C-terminus of endogenous nucl-1 locus. Nucleolar mKate2 expression. This strain can be used for auxin-inducible degradation (AID) of RPOA-2 in somatic tissues. Reference: Mejia-Trujillo R, et al. bioRxiv 2025.05.07.652530; doi: https://doi.org/10.1101/2025.05.07.652530.
ESC796 C. elegans wrdSi23 I; grwd-1(cse431[grwd-1::AID*::GFP]) III. Show Description
wrdSi23 [eft-3p::TIR1:F2A:mTagBFP::tbb2 3' UTR:: loxP] I. Maintain at 16-20C. AID*::GFP tag inserted at C-terminus of endogenous grwd-1 locus. This strain can be used for auxin-inducible degradation (AID) of GRWD-1 in somatic tissues. Reference: Mejia-Trujillo R, et al. bioRxiv 2025.05.07.652530; doi: https://doi.org/10.1101/2025.05.07.652530.
ESC797 C. elegans wrdSi23 I; grwd-1(cse431[grwd-1::AID*::GFP]) III; nucl-1(cse770[nucl-1::mKate2]) IV. Show Description
wrdSi23 [eft-3p::TIR1:F2A:mTagBFP::tbb2 3' UTR:: loxP] I. Maintain at 16-20C. AID*::GFP tag inserted at C-terminus of endogenous grwd-1 locus. mKate2 tag inserted into the C-terminus of endogenous nucl-1 locus. Nucleolar mKate2 expression. This strain can be used for auxin-inducible degradation (AID) of GRWD-1 in somatic tissues. Reference: Mejia-Trujillo R, et al. bioRxiv 2025.05.07.652530; doi: https://doi.org/10.1101/2025.05.07.652530.
ESC818 C. elegans wrdSi23 rpoa-2(cse772[AID*::GFP::rpoa-2]) I; set-2(ok952) III. Show Description
wrdSi23 [eft-3p::TIR1:F2A:mTagBFP::tbb2 3' UTR:: loxP] I. Maintain at 16-20C. AID*::GFP tag inserted at N-terminus of endogenous rpoa-2 locus. This strain can be used for auxin-inducible degradation (AID) of RPOA-2 in somatic tissues in a set-2 mutant background. Reference: Mejia-Trujillo R, et al. bioRxiv 2025.05.07.652530; doi: https://doi.org/10.1101/2025.05.07.652530.
ESC825 C.elegans wrdSi23 rpoa-2(cse772[AID*::GFP::rpoa-2]) I; ieSi11 II; nucl-1(cse770[nucl-1::mKate2]) IV. Show Description
wrdSi23 [eft-3p::TIR1:F2A:mTagBFP::tbb2 3' UTR:: loxP] I. ieSi11 [syp-3p::EmGFP::syp-3::syp-3 3'UTR + Cbr-unc-119(+)] II. Maintain at 16-20C. AID*::GFP tag inserted at N-terminus of endogenous rpoa-2 locus. GFP::SYP-3 expression is readily detected in spermatocytes and oocytes in the germline, and localizes to the interface between paired homologous chromosomes during most of meiotic prophase. mKate2 tag inserted into the C-terminus of endogenous nucl-1 locus. Nucleolar mKate2 expression. This strain can be used for auxin-inducible degradation (AID) of RPOA-2 in somatic tissues. Reference: Mejia-Trujillo R, et al. bioRxiv 2025.05.07.652530; doi: https://doi.org/10.1101/2025.05.07.652530.
ESC829 C.elegans wrdSi23 I; unc-104(knu973[unc-104::AID*]) rpoa-1(cse829[rpoa-1::AID*::GFP]) II. Show Description
wrdSi23 [eft-3p::TIR1:F2A:mTagBFP::tbb2 3' UTR:: loxP] I. Maintain at 16-20C. AID*::GFP tag inserted at the C-terminus of the endogenous rpoa-1 locus. This strain can be used for auxin-inducible degradation (AID) of RPOA-1 and UNC-104 in somatic tissues. Reference: Mejia-Trujillo R, et al. bioRxiv 2025.05.07.652530; doi: https://doi.org/10.1101/2025.05.07.652530.
ET137 C. elegans C30G12.1(ok910) II. Show Description
C30G12.1 Homozygous. No overt morphological or behavioral abnormalities. 1286 bp deletion. The region of cosmid C30G12 that is deleted is 39,238 - 40,523 bps (inclusive). The deletion includes an ectopic 5 bp sequence, GGTTA. The sequence crossing the deletion for ok910 is: ....GCCATGGTTAAAAGT GGTTA AAAAATTCAGTATAT... This deletion was generated by the C. elegans Gene Knockout Project at OMRF, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publication resulting from its use. http://www.mutantfactory.ouhsc.edu/
ET263 C. elegans ddb-1(tm1769)/dpy-20(e2017) IV. Show Description
Heterozygotes are WT and segregate WT, Dpy and ddb-1 homozygotes, which arrest as L2-stage larvae (approx. 15%) or become sterile adults with protruding vulva (approx. 85%).
ET507 C. elegans daf-16(mu86) I; cki-2(ok2105) II; glp-1(ar202) III. Show Description
Temperature-sensitive. Maintain at 15C. Animals form germline tumors that prevent fertility at restrictive temerature (25C). This is the first strain reported to be used for the isolation of germ cells for in vitro culture. This strain allows germ cells to remain viable for longer periods than other tumorous mutant strains tested. Reference: Chaudhari SH, et al. Dev Cell. 2016 Jul 11;38(1):33-46.
EU1008 C. elegans apo-5(or358) I. Show Description
Temperature sensitive, embryonic lethal mutant. 98% of embryos produced by homoygous mothers hatch at 15C; 0% produced at 26C hatch (but some viability at 25C). Mutation is recessive at 26C. First mitotic spindle in one-cell zygote is mis-positioned, often abnormally near the posterior pole; some chromosome segregation defects.
EU1065 C. elegans unc-119(ed3) III; orIs1. Show Description
Appears WT. orIs1 [pie-1p::GFP::mei-1 + unc-119(+)]. Maintain at 20C or above. Below 20C the GFP signal turns off.
EU1382 C. elegans orEx1. Show Description
orEx1[act-2 promoter::GFP::act-2 genomic fusion + rol-6(su1006)]. Shows cytoplasmic and cortical ACT-2::GFP expression in early embryonic cells, in epidermal cells during embryonic elongation, and in body wall muscle cells and some neurons in adults. All expression is zygotic; no germline expression is detected for this trangene even though act-2 is maternally expressed. Maintain by picking Rollers.
EU1424 C. elegans mom-2(or77) V/nT1 [unc-?(n754) let-?] (IV;V). Show Description
mom-2(or77) is a recessive, non-conditional maternal-effect embryonic lethal. Weak allele of mom-2/Wnt (splice acceptor mutation in last exon (exon6). 8% of mutant embryos lack gut. Heterozygotes are Unc.
EU149 C. elegans mex-3(or20)/hT1 I; +/hT1 V; lin-2(e1309) X. Show Description
Strain is egg-laying defective. Homozygous mex-3(or20) is a non-conditional maternal effect lethal: worms fill up with dead eggs. Heterozygotes bag with 11/16 dead embryos and larvae. About 10% of worms can lay eggs and be mated into for outcrossing. The mex-3(or20) mutant embryos produce excess body wall muscle anteriorly.