Strain Information
Name | EJ1171 View On Wormbase |
---|---|
Species | C. elegans |
Genotype | gon-2(q388) I; gem-1(bc364) X. |
Description | NOTE: Supplement media to 50 mM Mg2+ and grow at 15C for maximum fertility. The stock will propagate on non-supplemented media at 20 degrees, but this will potentially select for intragenic revertants of gon-2(q388). Temperature-sensitive failure of gonad precursor divisions. Penetrance of Gon phenotype is very high at 23.5C. At 25 degrees you can expect reduced brood sizes and some embryonic lethality. [Note: temperature sensitive period for gon-2(q388) begins prior to fertilization.] bc364 deletes 1,109 bp between AACATCTTGAATAACCATTCGGGAAGT and AAGTCATTCATTGCAGAGCTTACATTTAGTA. References: Kemp BJ, et al. Genetics. 2009 Feb;181(2):581-91. Sun AY & Lambie EJ. Genetics. 1997 Nov;147(3):1077-89. |
Mutagen | EMS |
Outcrossed | x4 |
Made by | Eric Lambie |
Laboratory | EJ |
Sign in
or
register an account if you want to order this strain.