Search Strains

or28 is a non-conditional maternal-effect embryonic lethal mutant ; the anterior pharynx is absent. and embryonic lethality is 100% penetrant. Pick single WT heterozygous hermaphrodites to maintain strain; these hets fill up with a mix of dead embryos and larvae [11/16 dead embryos due to aneuploidy from translocation segregation and lethal homozygous hT2; vulvaless due to homozygous lin-2(e1309) mutation; about 10% of lin-2(e1309) worms are leaky and lay eggs/can be mated into]. The homozygous or28 hermaphrodites fill up with dead embryos. The lin-2 background helps to score embryonic lethality for both heterozygotes and or28 homozygotes. or28 is a G to D mis-sense mutation at amino acid position 123.

or28 is a non-conditional maternal-effect embryonic lethal mutant ; the anterior pharynx is absent. and embryonic lethality is 100% penetrant. Pick single WT heterozygous hermaphrodites to maintain strain; these hets fill up with a mix of dead embryos and larvae [11/16 dead embryos due to aneuploidy from translocation segregation and lethal homozygous hT2; vulvaless due to homozygous lin-2(e1309) mutation; about 10% of lin-2(e1309) worms are leaky and lay eggs/can be mated into]. The homozygous or28 hermaphrodites fill up with dead embryos. The lin-2 background helps to score embryonic lethality for both heterozygotes and or28 homozygotes. Strain produces a lot of males due to him-8(ec56). or28 is a G to D mis-sense mutation at amino acid position 123.

Him. or28 is a non-conditional maternal-effect embryonic lethal mutant ; the anterior pharynx is absent. and embryonic lethality is 100% penetrant. Pick single WT heterozygous hermaphrodites to maintain strain; these hets produce 11/16 dead embryos due to aneuploidy from translocation segregation and lethal homozygous hT2. The homozygous or28 hermaphrodites produce all dead embryos with defective pharyngeal development. or28 is a G to D mis-sense mutation at amino acid position 123.

or28 is a non-conditional maternal-effect embryonic lethal mutant ; the anterior pharynx is absent. and embryonic lethality is 100% penetrant. Pick single WT heterozygous hermaphrodites to maintain strain; these hets produce 11/16 dead embryos due to aneuploidy from translocation segregation and lethal homozygous hT2. The homozygous or28 hermaphrodites produce all dead embryos with defective pharyngeal development. or28 is a G to D mis-sense mutation at amino acid position 123. Strain produces lots of males due to him-8(ec56).

Maintain at 15C; sterile at 26C. Shift to restrictive temperature (26C) for 3-6 hours to induce oocyte meiotic spindle phenotype and bypass sterility. Reference: Connolly A, et. al. Mol Biol Cell. 2014 Apr;25(8):1298-311.

ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. ojIs1 [pie-1p::GFP::tbb-2 + unc-119(+)]. Temperature-sensitive. Viable at 15C. Complete loss of aspm-1 function at 26C. Shift to restrictive temperature for 3-6 hours to induce oocyte meiotic spindle phenotype and bypass sterility. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.] Reference: Connolly A, et al. Mol Biol Cell. 2014 Apr;25(8):1298-311. PMID: 24554763

ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. ojIs1 [pie-1p::GFP::tbb-2 + unc-119(+)]. Temperature-sensitive embryonic lethal. Maintain at 15C. Shift to 25-26C for 2-6 hours to induce meiotic spindle phenotype. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.] Reference: Connolly AA, et al. J Cell Biol. 2015 Sep 14;210(6):917-32. PMID: 26370499

ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. ojIs1 [pie-1p::GFP::tbb-2 + unc-119(+)]. Maintain at 15C; sterile at 26C. Shift to restrictive temperature (26C) for 3-6 hours to induce oocyte meiotic spindle phenotype and bypass sterility. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.] Reference: Connolly A, et. al. Mol Biol Cell. 2014 Apr;25(8):1298-311.

ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. ojIs1 [pie-1p::GFP::tbb-2 + unc-119(+)]. Temperature-sensitive embryonic lethal. Maintain at 15C. Shift to 25-26C for 2-6 hours to induce meiotic spindle phenotype. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.] Reference: Connolly AA, et al. J Cell Biol. 2015 Sep 14;210(6):917-32. PMID: 26370499

Temperature-sensitive embryonic lethal. Maintain at 15C. Shift to 25-26C for 2-6 hours to induce meiotic spindle phenotype. Reference: Connolly AA, et al. J Cell Biol. 2015 Sep 14;210(6):917-32. PMID: 26370499

itIs37 [pie-1p::mCherry::H2B::pie-1 3'UTR + unc-119(+)] IV. GFP::aspm-1 localizes to meiotic spindle poles and centrosomes during early development. Temperature-sensitive embryonic lethal. Maintain at 15C. Shift to 25-26C for 2-6 hours to induce meiotic spindle phenotype. Reference: Connolly AA, et al. J Cell Biol. 2015 Sep 14;210(6):917-32. PMID: 26370499

Temperature-sensitive embryonic lethal. Maintain at 15C. Shift to 25-26C for 2-6 hours to induce meiotic spindle phenotype. Reference: Connolly AA, et al. J Cell Biol. 2015 Sep 14;210(6):917-32. PMID: 26370499

qIs26 [lag-2::GFP + rol-6(su1006)]. or1948 is a CRISPR/Cas9 engineered mutation in cls-1 causing a frameshift and premature stop. Heterozygotes are Rollers and GFP+ in the distal tip cell, and segregate heterozygotes (WT Rol), lethal qC1 homozygotes, and or1948 homozygotes (lay 100% dead embryos). Pick WT GFP+ Rol and check for correct segregation of progeny to maintain. Reference: Schlientz AJ & Bowerman B. (2020) C. elegans CLASP/CLS-2 negatively regulates membrane ingression throughout the oocyte cortex and is required for polar body extrusion. BioRxiv.

qIs26 [lag-2::GFP + rol-6(su1006)]. or1951 is a CRISPR/Cas9 engineered mutation in cls-1 causing a frameshift and premature stop. Heterozygotes are Rollers and GFP+ in the distal tip cell, and segregate heterozygotes (WT Rol), lethal qC1 homozygotes, and or1951 homozygotes (lay 100% dead embryos). Pick WT GFP+ Rol and check for correct segregation of progeny to maintain. Reference: Schlientz AJ & Bowerman B. (2020) C. elegans CLASP/CLS-2 negatively regulates membrane ingression throughout the oocyte cortex and is required for polar body extrusion. BioRxiv.

Heterozygotes are WT and segregate WT, Lon males, lots of dead eggs, and Dpys. The Dpys should give all dead embryos at all temperatures. Approximately 60% of these dead embryos make excess mesoderm at the expense of endoderm, due to an E to MS fate transformation. Embryonic lethality is 100% penetrant for or46.

Heterozygotes are WT and segregate WT, Lon males, lots of dead eggs, and Dpys. The Dpys should give all dead embryos at all temperatures. Approximately 60% of these dead embryos make excess mesoderm at the expense of endoderm, due to an E to MS fate transformation. Embryonic lethality is 100% penetrant for or10.

umnIs32 [myo-2p::GFP + NeoR, II: 11755713 (intergenic)] II. or1985 is a CRISPR/Cas9 engineered deletion of zyg-9 removing the entire open reading frame. Heterozygotes are wild-type and GFP+ and segregate WT GFP+ (hets), or1948 homozygotes (GFP-, lay 100% dead embryos) and paralysed DpyUnc GFP+ (mnC1 homozygotes). Maintain by picking WT GFP+. Reference: Harvey AM, et al. PLoS Genet. 2023 Jan 6;19(1):e1010363. doi: 10.1371/journal.pgen.1010363. PMID: 36608115

Heterozygous. Pick Unc to maintain. Heterozygotes are Unc and segregate Unc heterozygotes, wildtype (or2015 homozygotes that give only dead progeny), and and arrested nT1 aneuploids. Pick Unc and check for correct segregation of progeny to maintain. or2015 is a CRISPR/Cas9-engineered null allele removing the entire apx-1 open reading frame. Reference: Chuang CH, et al. G3 (Bethesda). 2025 Sep 26:jkaf229. doi: 10.1093/g3journal/jkaf229. PMID: 41004705.

mom-2(or85) is a recessive, non-conditional maternal-effect embryonic lethal. Strong allele; missense mutation near N-terminus: L77P. 85% of mutant embryos lack gut. Heterozygotes are Unc. [NOTE: (08-27-2014) We have been informed that the mutation carried in this strain is the same molecular lesion as or77. We are working to determine if or85 and or77 are in fact the same lesion or if an incorrect genotype was provided for the strain.]

Heterozygotes are WT and segregate WT and Uncs. The Uncs have a non-conditional maternal-effect embryonic lethal phenotype: the E blastomere adopts MS fate in about 5% of mutant embryos. The Uncs are 100% penetrant for embyronic lethality and morphogenesis defects.

Temperature sensitive. At 25C: Ste, during embryogenesis. Strong embryonic phenotype (anterior pharynx missing, no morophogenesis) if shifted during adulthood.

Heterozygotes are WT and segregate WT, DpySteriles and late embryonic or early larval lethals with incomplete elongation/morphogenesis.

Temperature-sensitive, embryonic-lethal mutant that lacks a central spindle during early embryonic mitosis and exhibits a late cytokinesis defect (cleavage furrows regress after ingressing in nearly to the center of dividing embryonic cells). About 100% of embryos produced by homozygous mothers hatch at 15C; 0% hatch at 26C. ZEN-4 = vertebrate MKLP1 kinesin. There are two mis-sense mutations present in zen-4(or153). One is a D520N (GAC to AAC) and the other is D735N (GAT to AAT). Whether one or both is responsible for the phenotype is not know. Maintain at 15C. Shift L4s to 26 overnight to observe mutant phenotype on embyros produced by adults.

Homozygous or195 hermaphrodites make 100% dead embryos at 26C. One-cell embryo has a very small but bipolar spindle, severe chromosome segregation defect. Maintain at 15C. Previously called spd-4. 2/06: From Bruce Bowerman: The or195 mutation changes base 10,679 of the cosmid clone T21E12 from a C to a T. This corresponds to dhc-1 cDNA nucleotide 9599 (WS153) , which is the center nucleotide of codon 3200. This codon changes from Serine in N2 to Leucine in or195 (S3200L). Note: this is not the same mutation for or195ts that we reported in Hamill et al, 2002(Dev Cell 3, 673-684). The mutation reported in our paper is not present in this strain. We apologize for the confusion. The pairs dhc-11a,b amplify the mutated fragment in dhc-1(or195). The mutation is near the center of this fragment; a clean (gel purified) DNA prep helps get a good read of it. dhc-11b: 5' aacagacgcacgattgacct 3'. dhc-11a: 5' ctcaaatcaaggaaggagct 3'. PCR conditions: 5 min at 94 degrees C; 30 sec at 94 degrees C; 30 sec at 55 degrees C; 1 min at 72 degrees C. 35 Cycles using Taq polymerase.

Maintain at 15C. Temperature-sensitive embryonic-lethal at restrictive temperature of 26C. Viable embryos at permissive temperature of 15C. Mitotic spindle in one-cell stage embryo assembles normally, but microtubules destabilize at anaphase and spindle becomes mis-positioned toward the posterior pole leading to highly abnormal cleavage and chromosome segregation defects. References: Gonczy P, et al. Dev Cell. 2001 Sep;1(3):363-75. Bellanger JM, et al. J Cell Sci. 2007 Aug 15;120(Pt 16):2963-73.

Homozygous nearly sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ef15 homozygotes (pale, nearly sterile, lays few eggs). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Reference: Schmid M, et al. Genes Dev. 2009 Apr 1;23(7):824-36.

efIs155 [mex-5p::rpl-4::FLAG::tbb-2 3?UTR + Cbr-unc-119(+)] II. Tagged RPL-4 can be used for ribosome purifications from germ cells. Reference: Nousch M, et al. G3 (Bethesda). 2020 Sep 3:g3.401644.2020. doi: 10.1534/g3.120.401644

Homozygous nearly sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ef8 homozygotes (nearly sterile, lays few eggs). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Reference: Rybarska A, et al. PLoS Genet. 2009 May;5(5):e1000494.

[NOTE: (10/22/2020) This strain also carries a (T to A) missense mutation in pry-1 which results in a PRY-1 N354K amino acid substitution.] bar-1(ga80) hermaphrodites are usually Egl and often have a protruding vulva (Pvl), although approx. 40% of animals appear WT on plates. Also slightly Unc. In bar-1(ga80) hermaphrodites any of the six vulval precursor cells (P3.p - P8.p) can sometimes fuse with hyp7 without dividing, and P5.p - P7.p can adopt the tertiary cell fate instead of the primary or secondary fates. In addition, the neuroblast QL and its progeny migrate towards the anterior instead of the posterior, and the cell P12 usually adopts the fate of P11. bar-1(ga80) do mate, but poorly. bar-1 encodes a beta-catenin molecule and the ga80 mutation is predicted to cause an early truncation of the protein.

Temperature-sensitve sterile. Maintain at 15-20C. Superficially wild-type at permissive temperatures; contains large bubble-like structures on the inside in all stages (described as large early endosomes), reduced brood size. Sterile and very sick at 25°C with some single escapers that are sterile and sick themselves. Suppressors have been observed after long culturing over several months, periodically check for sterility at 25C.

zzIs16 [(pJE3) eff-1p::GFP + rol-6(su1006)]. GFP+ Rollers. Chromosomal insertion of zzEx10. Integration site of zzIs16 not yet mapped, but it is not tightly linked to eff-1 II, unc-119 III, or jcIs1 IV. pJE3 has 7.5 kb of eff-1 upstream sequence inserted into pPD95.75, driving cytoplasmic GFP expression.

Hypomorphic allele. Fully viable and fertile. Strongly uncoordinated larvae, tend to coil backward. Dpyish, mildly Unc adults. Isolated out of a mutator strain also containing uncharacterized e2281 and e2282.

Extreme coiler from L1 to adult. Hypomorph. f131/nDf17 is L1 lethal. Molecular lesion: g to a transition in splice donor site of exon 6 (g3485a) in ZK637.8 gene encoding a V-ATPase alpha subunit.

fgpIs20 [(pFGP79) pie-1p::mCherry::smo-1(GG) + unc-119(+)]. Propagate at 20-25°C. Switching to 25C prior to imaging may enhance the signal from fgpIs20. Allows SUMO localization/conjugation to be observed within the germline and embryos. Reference: Pelisch et al. Nat Commun. 2014 Dec 5;5:5485.

fgpIs21 [(pFGP80) pie-1p::mCherry::smo-1(GA) + unc-119(+)]. Propagate at 20-25°C. Switching to 25C prior to imaging may enhance the signal. May be used to follow unconjugated SUMO localization within the germline and embryo. When compared with strain FGP1, the difference in fluorescence signal corresponds to SUMO conjugation in FGP1. Reference: Pelisch et al. Nat Commun. 2014 Dec 5;5:5485.

fgpIs23 [(pFGP78) pie-1p::GFP::TEV-S-Tag::smo-1(GG) + unc-119(+)]. Propagate at 20-25°C. Switching to 25C prior to imaging may enhance the signal. Allows SUMO localization/conjugation to be observed within the germline and embryos. Reference: Pelisch et al. Nat Commun. 2014 Dec 5;5:5485.

fgpIs24 [(pFGP77) pie-1p::GFP::TEV-S-Tag::smo-1(GA) + unc-119(+)]. Propagate at 20-25°C. Switching to 25C prior to imaging may enhance the signal. When compared with strain FGP3, the difference in fluorescence signal corresponds to SUMO conjugation in FGP3. Reference: Pelisch et al. Nat Commun. 2014 Dec 5;5:5485.

ruIs57 [pie-1p::GFP::tubulin + unc-119(+)]. Expression of GFP::tubulin fusion in germline and early embryos. fgpIs20 [(pFGP79) pie-1p::mCherry::smo-1(GG) + unc-119(+)]. Propagate at 20-25°C. Switching to 25C prior to imaging may enhance the signal from fgpIs20. Allows SUMO localization/conjugation to be observed within the germline and embryos. Reference: Pelisch et al. Nat Commun. 2014 Dec 5;5:5485.

ruIs32 [pie-1p::GFP::H2B + unc-119(+)] III. Expression of GFP::H2B histone fusion in germline. fgpIs20 [(pFGP79) pie-1p::mCherry::smo-1(GG) + unc-119(+)]. Propagate at 20-25°C. Switching to 25C prior to imaging may enhance the signal from fgpIs20. Allows SUMO localization/conjugation to be observed within the germline and embryos. Reference: Pelisch et al. Nat Commun. 2014 Dec 5;5:5485.

cdk-5(gm336) mutants exhibit defects in polarized trafficking of dense-core vesicles in motor neurons, and decreased localization of GLR-1::GFP to puncta in ventral nerve cord interneurons. Note that this strain does not contain GLR-1::GFP. References: Juo P, et al. Mol Biol Cell. 2007 Oct;18(10):3883-93. Goodwin PR, et al. J Neurosci. 2012 Jun 13;32(24):8158-72.

Deletion of the tyrosine kinase domain of kin-8. Partial Daf-c especially on an old lawn of E. coli. Reduced daf-7 expression in ASI. Dye-filling defective in ASI. Abnormal ASI cell position. 10-20% of animals show withered (Wit) tail phenotype or defects in elongation or migration of posterior gonad. Previously called kin-8.

Hypersensitive to copper and cadmium ions, and to starvation. [NOTE: Prior studies suggested possible cross-regulation of PMK-1 by MEK-1, but the identification of a tightly linked partial loss-of-function mutation in sek-1(qd127) in the strain carrying the mek-1(ks54) mutant allele (K. Reddy and D. Kim, unpublished data) suggests that the diminished PMK-1 activation observed in this mutant strain may actually be due to diminished SEK-1 activity.]

ksEx29 [daf-7::GFP + lin-44::GFP]. Maintain by picking GFP. daf-7::GFP is dark or invisible. lin-44::GFP is bright in the tail. Grows better at 15C.

xnIs506 [cdc42p::GST::GFP::wsp-1(GBD) + unc-119(+)]. Biosensor for active CDC-42. In epithelia, GFP is enriched at junctions between epithelial cells. Some signal is in the nucleus (this signal is reduced by addition of GST, which makes the transgenic protein larger). Reference: Zilberman, Y., J. Abrams, D.C. Anderson, and J. Nance. 2017. Cdc42 regulates junctional actin but not cell polarization in the Caenorhabditis elegans epidermis. J Cell Biol 216: 3729-3744.

xnIs371 [pie-1p::GFP::pac-1(1-574) + unc-119(+)]. xnEx384 [hsp16p::HA::phplc1(delta)1::hmr-1(ICD) + rol-6(su1006)]. Rollers. Rollers express HMR-1 intracellular domain pan-cortically in cells upon heat shock. Maintain at 15C or 20C to prevent leaky expression of heat shock transgene. Reference: Klompstra D, et al. Nat Cell Biol. 2015 Jun;17(6):726-35.

xnIs371 [pie-1p::GFP::pac-1(1-574) + unc-119(+)]. xnEx385 [hsp16p::HA::phplc1(delta)1::hmr-1(ICD-M) + rol-6(su1006)]. Rollers. Rollers express mutated HMR-1 intracellular domain (unable to bind catenins) pan-cortically in cells upon heat shock. Maintain at 15C or 20C to prevent leaky expression of heat shock transgene. Reference: Klompstra D, et al. Nat Cell Biol. 2015 Jun;17(6):726-35.

Heterozygotes are Dpy. Segregate Dpy Unc. tm939 homozygotes are emb, leth, pvl, rup, larval arrested or sterile. Attribution: This strain was generated by the National Bioresource Project at the Tokyo Women's Medical University School of Medicine, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Homozygous lethal or sterile deletion allele balanced by Unc-marked translocation. Break points: In(egl-4 unc-17) IV. Covered region (Mb) 1.8 (1.8..3.6) Unc. Reference: Iwata S, et al. Sci Rep. 2016 Sep 21;6:33840.

Break points: In(F13D12.6 Y51H1A.2) II. Covered region (Mb) 2.1 (11.7..13.9) Obtained by TMP/UV. (Note: Y51H1A.2 has been renamed cup-14.) [NOTE: the genotype originally listed for this strain in Table 2 of Dejima, et al. was incorrect.] Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.

Homozygous lethal or sterile deletion allele balanced by Unc-marked translocation. Break points: In(mec-3 unc-31) IV. Covered region (Mb) 2.3 (10.5..12.8) Unc. Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.