| EM253 |
C. elegans |
mab-20(bx61) I; him-5(e1490) V. Show Description
Ray 3 and 4 fusion >60% at non-permissive temp. Ray 1 and 2 fusion about 10% at non-permissive temp. ts period is around L3-L4.
|
|
| EM67 |
C. elegans |
mab-20(bx24) I; him-5(e1490) V. Show Description
Extensive ray fusion. Posterior portion of body swollen at larval stages.
|
|
| VC4164 |
C. elegans |
mab-20(gk5250[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) I. Show Description
Homozygous viable. Deletion of 3445 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: ACTGAGAATTGGGAGACACCGGCTCCAGAC ; Right flanking sequence: TAAAATTAAACGTCGGATCCACAACACAAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| NW1701 |
C. elegans |
mab-20(ev778) I; muIs32 II; him-5(e1490) V. Show Description
muIs32 [mec-7p::GFP + lin-15(+)]. Extensive ray fusion. Body morphology defects at larval stages. Embryonic and larval lethality.
|
|
| NW1696 |
C. elegans |
him-5(e1490) V; evIs138. Show Description
evIs138 [plx-2(+) + sur-5::GFP]. Enhances sensory ray fusion defect of mab-20(bx61). No fusions as single.
|
|
| NW1697 |
C. elegans |
plx-2(ev775) II; him-5(e1490) V. Show Description
Enhances sensory ray fusion defect of mab-20(bx61). No fusions as single.
|
|
| NW1698 |
C. elegans |
plx-2(ev774) II; him-5(e1490) V. Show Description
Enhances sensory ray fusion defect of mab-20(bx61). No fusions as single.
|
|
| NW1699 |
C. elegans |
plx-2(ev738) II; him-5(e1490) V. Show Description
Enhances sensory ray fusion defect of mab-20(bx61). No fusions as single.
|
|
| NW1700 |
C. elegans |
plx-2(ev773) II; him-5(e1490) V. Show Description
Null allele. Enhances sensory ray fusion defect of mab-20(bx61). No fusions as single. Some embryonic and larval lethality.
|
|