Search Strains

More Fields See WormTagDB for other published tagged loci.
Strain Species Genotype Add
JK3447 C. elegans fog-1(q250)/sep-1(e2406) I; fbf-1(ok91) fbf-2(q704)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
To maintain, check individual fertile worms for both Sep and Fog offspring. sep-1 homozygotes are sterile at 20C and 25C (Sterile and Unc at 25C), and mostly normal at 15C. fog-1; fbf-1 fbf-2 homozygotes have small germ lines and are often Muv. Best to maintain at 25C for scoring. Do not distribute this strain; other labs should request it from the CGC.
JK3744 C. elegans qIs89. Show Description
qIs89 [gon-14::gon-14::VENUS + S. cerevisiae DNA]. gon-14::VENUS is broadly expressed in cell nuclei starting at the 50-100 cell stage of embryogenesis and throughout larval development. Partially concentrated in nuclear speckles. qIs89 rescues the 25C Gon and Ste defects of q686. Low penetrance of sterility and lethality in the strain. Do not distribute this strain; other labs should request it from the CGC.
JK3965 C. elegans fbf-1(ok91) fbf-2(q704)/mIn1 [mIs14 dpy-10(e128)] II; fem-3(e1996)/qIs24 IV. Show Description
qIs24 [lag-2p::GFP]. Maintain by picking individual animals with green DTCs and green pharynx and scoring offspring for Fems and Fbfs. fem-3 is not well balanced by qIs24. fbf-1 fbf-2 homozygotes are germline proliferation defective and make only sperm. fem-3 homozygotes make only oocytes. fbf-1 fbf-3; fem-3 proliferates more than fbf-1 fbf-2 and makes only oocytes; also Muv. qIs24 contains lag-2::GFP; Distal Tip Cells are green; homozygotes are Rollers and heterozygotes Roll weakly. mIn1 is Dpy and GFP+ in the pharynx. Do not distribute this strain; other labs should request it from the CGC.
JK4619 C. elegans tra-1(q106) III/eT1[qIs60](III;V). Show Description
qIs60 [pes-10::GFP + gut specific promoter::GFP + myo-2::GFP]. Heterozygotes are wild-type GFP+ and segregate wild-type GFP+ heterozygotes, non-GFP males, and dead eggs (eT1 homozygotes). Pick wild-type GFP+ and check for proper segregation of progeny to maintain. Reference: Schedl T, et al. Genetics. 1989 Dec;123(4):755-69. doi: 10.1093/genetics/123.4.755. PMID: 2612895.
JK5008 C. elegans qSi44 II; glp-1(q46) III. Show Description
qSi44 [glp-1::6xMyc6xHis + Cbr-unc-119(+)] II. Homozygous viable. Variable body length. May still carry unc-119(ed3) in the background. Reference: Sorensen EB, et al. A toolkit of tagged glp-1 alleles reveals strong glp-1 expression in the germline, embryo, and spermatheca. microPublication Biology, 2020(06). http://doi.org/10.17912/micropub.biology.000271
JK5028 C. elegans qSi77 II; unc-119(ed3) III. Show Description
qSi77 [mex-5p::eGFP::3xFLAG::tbb-1 3'utr::gpd-2 SL2 splice site::mCherry::3xMyc::pgl-1 RGG repeat::tbb-1 3'utr and intergenic region + unc-119(+)] inserted into ttTi5605 on LG II. References: Noble DC, et al. Genetics. 2016 Jan;202(1):221-34.
JK5226 C. elegans glp-1(q46) III; qSi156 IV. Show Description
qSi156 [glp-1::Halotag + Cbr-unc-119(+)] IV. Mos insertion of Halo tagged GLP-1 in glp-1(null) background. qSi156 mostly rescues glp-1(q46) sterility; partially penetrant embryonic lethality, early larval lethality and dumpiness. Reference: Sorensen EB, et al. A toolkit of tagged glp-1 alleles reveals strong glp-1 expression in the germline, embryo, and spermatheca. microPublication Biology, 2020(06). http://doi.org/10.17912/micropub.biology.000271
JK551 C. elegans unc-5(e53) fem-3(q22) IV. Show Description
Temperature sensitive. At 25C, XX germline makes only sperm; at 15C, germline makes oocytes and excess sperm. Unc. Do not distribute this strain; other labs should request it from the CGC.
JK5535 C. elegans glp-1(q46) III; qSi246 IV. Show Description
qSi246 [glp-1::sfGFP + Cbr-unc-119(+)] IV. Mos insertion of sfGFP tagged GLP-1 in glp-1(0) background. qSi246 rescues glp-1(q46) sterile phenotype. Animals are fertile, superficially wild-type with GFP+ distal germ-lines. Reference: Sorensen EB, et al. A toolkit of tagged glp-1 alleles reveals strong glp-1 expression in the germline, embryo, and spermatheca. microPublication Biology, 2020(06). http://doi.org/10.17912/micropub.biology.000271
JK5848 C. elegans nos-3(q958[nos-3::1xOLLAS]) II. Show Description
1xOLLAS tag inserted into endogenous nos-3 locus via CRISPR/Cas9 engineering.
JK5896 C. elegans qSi369 II; unc-119(ed3) III; qSi370 V. Show Description
qSi369 [sygl-1p::24xMS2 loops::3xflag::sygl-1::sygl1 3'UTR]. qSi370 [mex-5p:: MS2 Coat Protein::linker::sfGFP::tbb-2 3' UTR::gpd-2 intergenic sequence::H2B::mCherry::unc-54 3' UTR]. Superficially wild-type with expression of sfGFP and nuclear mCherry in germline. qSi369 and qSi370 constitute an MS2 system which allows live visualization of sygl-1 nascent transcripts in the C. elegans germline in a glp-1 mutant background. qSi370 can be prone to silencing, especially after severe starvation; silencing of GFP or mCherry expression can occur independently of one another. Maintain by picking animals with bright GFP and mCherry expression. Reference: Lee C, et al. Dev Cell. 2019 Aug 19;50(4):426-435.e4.
JK5933 C. elegans glp-1(q1000[glp-1::4xV5]) III. Show Description
Endogenous glp-1 locus tagged with 4xV5. Tagged GLP-1 rescues: glp-1(q1000) is fertile and progenitor zone looks wild-type. Reference: Sorensen EB, et al. A toolkit of tagged glp-1 alleles reveals strong glp-1 expression in the germline, embryo, and spermatheca. microPublication Biology, 2020(06). http://doi.org/10.17912/micropub.biology.000271
JK5973 C. elegans glp-1(q997[glp-1::2xOLLAS]) III. Show Description
Endogenous glp-1 locus tagged with 2x OLLAS. Tagged GLP-1 rescues: glp-1(q997) is fertile and progenitor zone looks wild-type. Reference: Sorensen EB, et al. A toolkit of tagged glp-1 alleles reveals strong glp-1 expression in the germline, embryo, and spermatheca. microPublication Biology, 2020(06). http://doi.org/10.17912/micropub.biology.000271
JK6011 C. elegans lst-1(q1032[*q1004]) I. Show Description
q1004[LST-1::3xV5] is the CRISPR-engineered insertion of a 3xV5 tag at the C-terminus of the endogenous lst-1 locus. q1032 is the CRISPR-engineered mutation C260S & C263S in the Zn finger domain of LST-1 (Haupt et al., 2019) in the q1004 background. Reference: Haupt KA, et al. Development. 2019 Oct 17;146(20):dev181644. doi: 10.1242/dev.181644. PMID: 31515205.
JK6045 C. elegans glp-1(q1036) III. Show Description
Maintain at 15C. Germline tumor formation at 25C. A mix of fertile wild-type and proximal tumorous animals at 20C. glp-1(ar202) V5 CRISPR/Cas9 gene editing was used to insert a 3xV5 tag into C-terminus of GLP-1 between amino acids K(1209) and S(1210) using the same reagents as described for tagging wild-type GLP-1 (Sorensen et al., 2020). GLP-1 ar202V5 germlines express GLP-1 in membranes.
JK6059 C. elegans glp-1(q1035[*q1000]) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Pick GFP+ to maintain. CRISPR-engineered RAM mutations in endogenous glp-1 locus with C-terminal 4xV5 tag. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP q1035 homozygotes (sterile). Homozygous hT2[bli-4 let-? qIs48] inviable. Maintain by picking GFP+ heterozygotes and checking for correct segregation of progeny to maintain a balanced stock. Derived by modification of parental strain JK5933 glp-1(q1000).
JK6063 C. elegans puf-8(q1048[3xV5::puf-8]) II. Show Description
3xV5 tag inserted into endogenous puf-8 locus via CRISPR/Cas9 engineering. Reference: Ferdous AS, et al. Development. 2023 May 1;150(9):dev201705. PMID: 37070766.
JK6091 C. elegans gld-3(q1065[gld-3L::1xV5]) II. Show Description
1xV5 tag inserted into endogenous gld-3 locus, specifically tagging GLD-3L isoform, via CRISPR/Cas9 engineering.
JK6099 C. elegans lag-2(q1049[lag-2::3xV5]) V. Show Description
CRISPR/Cas9 gene editing was used to insert a 3xV5 tag at the C-terminus of the endogenous lag-2 locus immediately upstream of stop codon. Animals are fertile and express LAG-2 V5 in adult DTCs.
JK6111 C. elegans sygl-1(q1054[*q943]) I. Show Description
C-teminal V5 epitope tag inserted into endogenous sygl-1 locus that has a CRISPR-engineered mutation of predicted Notch-dependent cis-regulatory element LBS D (Yoo et al., 2004). Reference: Lynch TR, et al. Development. 2022 Apr 1;149(7):dev200332. PMID: 35394007.
JK6140 C. elegans nos-3(q902) II; qSi380 IV. Show Description
qSi380 [mex-5p::eGFP::3xOLASS::linker::his-58::MODC pest::3xboxb::tbb-2 3'UTR::SL2 trans-splice site::mCherry::3xV5::linker::his-58::MODC pest::mutant 3xboxb::tbb-2 3'utr::tbb-1 intergenic region] IV. Worms are fertile at 20C. Improved tethering assay for use in the C. elegans germline. GFP reporter mRNA is under control of a germline-expressed mex-5 promoter and has three boxB stem-loops in its 3'UTR. The RNA-binding protein (RBP) is tagged with lamda-N. The nascent transcript driven by mex-5 promoter is resolved by trans-splicing into two mRNAs that encode distinct reporters. The GFP reporter RNA has three functional boxB stem-loops in its 3'UTR; the mCherry reporter 3'UTR has three mutated boxB stem-loops that do not bind lamda-N and therefore provides an internal control. Addition of an OLLAS tag to GFP and a V5 tag to mCherry enables sensitive immunostaining and immunoblotting. Reference: Doenier J, et al. RNA. 2021 Jun;(6)643-652. PMID: 33727224.
JK6179 C. elegans gld-2(q1100[gld-2::2xV5]) I. Show Description
2xV5 tag inserted into endogenous gld-2 locus via CRISPR/Cas9 engineering.
JK6251 C. elegans apx-1(q1148[apx-1::3xV5]) V. Show Description
CRISPR/Cas9 gene editing was used to insert a 3xV5 tag inserted at the C-terminus of the endogenous apx-1 locus immediately upstream of STOP codon. Animals are fertile and express low levels of APX-1 V5 in adult DTCs.
JK6268 C. elegans qSi380 IV. Show Description
qSi380 [mex-5p::eGFP::3xOLASS::linker::his-58::MODC pest::3xboxb::tbb-2 3’utr::SL2 trans-splice site::mCherry::3xV5::linker::his-58::MODC pest::mutant 3xboxb::tbb-2 3'utr::tbb-1 intergenic region] IV. Worms are fertile at 20C. Improved tethering assay for use in the C. elegans germline. GFP reporter mRNA is under control of a germline-expressed mex-5 promoter and has three boxB stem–loops in its 3′UTR. The RNA-binding protein (RBP) is tagged with lamda-N. The nascent transcript driven by mex-5 promoter is resolved by trans-splicing into two mRNAs that encode distinct reporters. The gfp reporter RNA has three functional boxB stem–loops in its 3′UTR; the mCherry reporter 3′UTR has three mutated boxB stem–loops that do not bind lamda-N and therefore provides an internal control. Addition of an OLLAS tag to GFP and a V5 tag to mCherry enables sensitive immunostaining and immunoblotting. Reference: Doenier J, et al. RNA. 2021 Jun;(6)643-652. PMID: 33727224.
JK6383 C. elegans mpk-1(q1147[V5::mpk-1B] q1183[mpk-1AB::2xOLLAS]) III. Show Description
Endogenous mpk-1 locus tagged with a single V5 tag inserted into the mpk-1b-specific exon to specifically label the N-terminus of the MPK-1B protein, and two tandem OLLAS tags inserted into the C-terminus, labeling both MPK-1A and MPK-1B isoforms. Reference: Robinson-Thiewes et al. Cell Reports, In Press.
JK6389 C. elegans sygl-1(q1167[*q1135])) I. Show Description
C-teminal V5 epitope tag inserted into endogenous sygl-1 locus that has a CRISPR-engineered mutation of predicted Notch-dependent cis-regulatory elements LBS BCD (Yoo et al., 2004). Reference: Lynch TR, et al. Development. 2022 Apr 1;149(7):dev200332. PMID: 35394007.
JK6399 C. elegans lst-1(q1198[*q867]) I. Show Description
3xV5 epitope tag inserted into endogenous lst-1 locus with a 1 bp deletion in lst-1L-specific first exon tospecifically disrupt LST-1L isoform. Synthetically sterile in combination with sygl-1(lf). Reference: Haupt KA, et al. 2019 Oct 17;146(20):dev181644. PMID: 31515205.
JK6403 C. elegans mpk-1(q1147[V5::mpk-1B] q1201[mpk-1B del] q1183[mpk-1AB::2xOLLAS])/qC1 [qIs56] III. Show Description
qIs56 [lag-2p::GFP + unc-119(+)]. q1201 is a 125 bp deletion causing a frameshift in mpk-1B without affected mpk-1A. Heterozygous animals Roll and have GFP+ distal tip cells. Segregates roller GFP(+) heterozygotes and non-roller GFP(-) mpk-1 homozygotes (sterile, but form a vulva). qC1 [dpy-19(e1259) glp-1(q339) qIs26] homozygotes are not viable. Endogenous mpk-1 locus tagged with a single V5 tag inserted into the mpk-1b-specific exon to specifically label the N-terminus of the MPK-1B protein, and two tandem OLLAS tags inserted into the C-terminus, labeling both MPK-1A and MPK-1B isoforms. Reference: Robinson-Thiewes et al. Cell Reports, In Press.
JK6468 C. elegans gld-3(q1215[*q1065]) II. Show Description
1xV5 tag inserted into endogenous gld-3 locus containing K864A & L867A engineered mutations, specifically tagging GLD-3L isoform. GLD-3L::1xV5 (K864A, L867A) animals are 30% Fog. Derived by CRISPR-engineered mutation of parental strain JK6091.
JK6509 C. elegans fbf-1(q1227) fbf-2(q945[3xFLAG::fbf-2])/mIn1 [mIs14 dpy-10(e128)] II. Show Description
Pick wild-type GFP+ to maintain. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP+ (heterozygotes), Dpy bright GFP+ (mIn1 homozygotes), and non-GFP fbf-1 fbf-2 homozygotes. fbf-1(q1227) fbf-2(q945[3xFLAG::fbf-2]) homozygotes are partially sterile, ~50% make excess sperm and delay oogenesis resulting in delayed egg laying when compared to wild-type animals. Pick WT dim GFP and check for correct segregation of progeny to maintain. q1227 is an engineered Y477A point mutation in FBF-1 derived by modification of parental strain JK5810.
JK6600 C. elegans lst-1(q869) sygl-1(q1167) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Pick GFP+ to maintain. C-teminal V5 epitope tag inserted into endogenous sygl-1 locus that has a CRISPR-engineered mutation of predicted Notch-dependent cis-regulatory elementa LBS BCD (Yoo et al., 2004). Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP q869 q1167 homozygotes (sterility/reduced fertility). Homozygous hT2[bli-4 let-? qIs48] inviable. Maintain by picking GFP+ heterozygotes and checking for correct segregation of progeny to maintain a balanced stock. Reference: Lynch TR, et al. Development. 2022 Apr 1;149(7):dev200332. PMID: 35394007.
JK6673 C. elegans fzr-1(q1290[3xV5::fzr-1]) II. Show Description
Endogenous fzr-1 locus tagged with 3xV5 close to the N-terminus. Insertion site is a few amino acids downstream of start site (...PAN-3xV5-SPA…). Primer sequences to validate the strain: slc316 GCTTTTGCGTGTTCTCCTCA, slc317 TGAATCCTGAGTCATCATCCGAGT, WT product 347 bp, q1290[3xV5::fzr-1] product 485 bp.
JK816 C. elegans fem-3(q20) IV. Show Description
Gain of function. Temperature sensitive. XX germline makes only sperm at 25C; XX germline makes oocytes and excess sperm at 15C. Do not distribute this strain; other labs should request it from the CGC.
JLF145 C. elegans zif-1(gk117) III; air-1(wow14[air-1::ZF1::GFP::3xFLAG]) V. Show Description
ZF1-degron, GFP, and 3xFLAG tags inserted into endogenous air-1 locus. No overt phenotypes in a zif-1(gk117) background. Predicted no degradation because zif-1 putative null is present. Can be used for degradation of air-1 protein by providing a source of ZIF-1. GFP expression is observed in mitotic cells at the spindle poles and along microtubules. Reference: Sallee M, et al. PLoS Biol. 2018 Aug 6;16(8):e2005189. doi: 10.1371/journal.pbio.2005189. PMID: 30080857.
JLF361 C. elegans spd-5(wow52[GFP:3xFlag:spd-5]) I. Show Description
GFP and 3xFLAG tags inserted into endogenous spd-5 locus. No overt phenotypes. GFP fluorescence is observed at centrosomes and ciliary base. Reference: Magescas J, et al. eLife. 2019 Jun 27;8:e47867. doi: 10.7554/eLife.47867. PMID: 31246171.
JLF425 C. elegans spd-5(wow36[tagRFP-T::spd-5]) spd-2(wow60[spd-2::GFP::3xFlag]) I. Show Description
tagRFP-T tag inserted into endogenous spd-5 locus. GFP and 3xFLAG tags inserted into endogenous spd-2 locus. No overt phenotypes. GFP and RFP fluorescence is observed at centrosomes. Reference: Magescas J, et al. eLife. 2019 Jun 27;8:e47867. doi: 10.7554/eLife.47867. PMID: 31246171.
JM126 C. elegans pho-1(ca101ca102) II. Show Description
Partial maternal effect lethal. Lack of PHO-1 acid phosphatase activity on isoelectric focusing gel.
JMC151 C. elegans csr-1(tor160[csr-1 exon1::GFP::FLAG (IV:7957568)]) IV . Show Description
GFP and 3xFLAG tags inserted into first exon of endgonenous csr-1 locus (IV:7957568); specifically tags a-isoform.
JMC201 C. elegans alg-1(tor137[GFP::3xFLAG::alg-1b]) X. Show Description
GFP and 3xFLAG tags inserted into endgonenous alg-1 locus; specifically tags b-isoform. Reference: Seroussi U, et al. bioRxiv 2022.08.08.502013; doi: https://doi.org/10.1101/2022.08.08.502013
JMC203 C. elegans alg-2(tor139[GFP::3xFLAG::alg-2b]) II. Show Description
GFP and 3xFLAG tags inserted into endgonenous alg-2 locus; specifically tags b-isoform. Reference: Seroussi U, et al. bioRxiv 2022.08.08.502013; doi: https://doi.org/10.1101/2022.08.08.502013
JMC211 C. elegans ergo-1(tor147[GFP::3xFLAG::ergo-1a]) V. Show Description
GFP and 3xFLAG tags inserted into endgonenous ergo-1 locus; specifically tags a-isoform. Reference: Seroussi U, et al. bioRxiv 2022.08.08.502013; doi: https://doi.org/10.1101/2022.08.08.502013
JMC225 C. elegans ppw-1(tor119[GFP::3xFLAG::ppw-1c]) I. Show Description
GFP and 3xFLAG tags inserted into endgonenous ppw-1; specifically tags c-isoform. Reference: Seroussi U, et al. bioRxiv 2022.08.08.502013; doi: https://doi.org/10.1101/2022.08.08.502013
JMC227 C. elegans sago-2(tor121[GFP::3xFLAG::sago-2c]) I. Show Description
GFP and 3xFLAG tags inserted into endgonenous sago-2; specifically tags c-isoform. Reference: Seroussi U, et al. bioRxiv 2022.08.08.502013; doi: https://doi.org/10.1101/2022.08.08.502013
JMC245 C. elegans alg-4(tm1184) III; csr-1(tor67[csr-1 exon2::gfp::3xflag (IV:7958598)], csr-1(mg660[G120*])) alg-3(tm1155) IV; wago-10(tor133) V. Show Description
Quadruple mutant of four spermatogenesis-specific ago genes. Reference: Charlesworth AG, et al. Nucleic Acids Res. 2021 Sep 7;49(15):8836-8865. PMID: 34329465
JN2113 C. elegans peIs2113. Show Description
peIs2113 [gcy-21p::mCaspase + tax-4p::NLS::YC2.60 + lin-44p::GFP]. Genetic ablation of ASG neurons by specific expression of caspase. tax-4p::YC2.60 facilitates calcium imaging. Reference: Jang MS, et al. Proc Natl Acad Sci U S A. 2019 Sep 10;116(37):18673-18683. PMID: 31455735
JN2722 C. elegans daf-2(pe2722) III. Show Description
daf-2(pe2722) is a daf-2c-isoform specific mutation. pe2722 is a CRISPR/Cas9-engineered 41 bp deletion (ggttgatgacgatgatgagcccggcggcaggaggcagtgagcaaca) in daf-2 exon 11.5. Guide RNA sequence: gacgatgaagagcccggcgg. Reference: Nagashima T, et al. PLoS Genet. 2019 Jul 19;15(7):e1008297. PMID: 31323047
JN578 C. elegans peIs578. Show Description
peIs578 [npr-9p::casp1 + npr-9p::Venus + unc-122p::mCherry]. AIB neurons are ablated by specific expression of caspase. Reference: Kunitomo H, et al., 2013, Nat Commun. 2013;4:2210. doi: 10.1038/ncomms3210.
JN579 C. elegans peIs579. Show Description
peIs579 [ttx-3p::casp1 + ttx-3p::Venus + lin-44p::GFP]. AIY neurons are ablated by specific expression of caspase. Reference: Kunitomo H, et al., 2013, Nat Commun. 2013;4:2210. doi: 10.1038/ncomms3210.
JN580 C. elegans peIs580. Show Description
peIs580 [ins-1p(short)::casp1 + ins-1p(short)::Venus + unc-122p::GFP]. AIA neurons are ablated by specific expression of caspase. Reference: Kunitomo H, et al., 2013, Nat Commun. 2013;4:2210. doi: 10.1038/ncomms3210.
JN785 C. elegans peIs785. Show Description
peIs785 [casy-1p::daf-2 E11-E11.5(+c)-E12::EGFP + casy-1p::daf-2 E11-E11.5(+c)-E12(-c)::mRFP]. peIs785 caries a daf-2 splicing reporter expressed in many neurons. Reference: Tomioka M, et al. Nat Commun. 2016 May 20;7:11645. PMID: 27198602