Strain Information

Name JK6673   View On Wormbase
Species C. elegans
Genotypefzr-1(q1290[3xV5::fzr-1]) II.
DescriptionEndogenous fzr-1 locus tagged with 3xV5 close to the N-terminus. Insertion site is a few amino acids downstream of start site (...PAN-3xV5-SPA…). Primer sequences to validate the strain: slc316 GCTTTTGCGTGTTCTCCTCA, slc317 TGAATCCTGAGTCATCATCCGAGT, WT product 347 bp, q1290[3xV5::fzr-1] product 485 bp.
MutagenCrispr/Cas9
Outcrossedx2
Made bySarah Crittenden
Laboratory JK
Reference Not published.
Sign in or register an account if you want to order this strain.