Strain Information
| Name | JK6673 View On Wormbase |
|---|---|
| Species | C. elegans |
| Genotype | fzr-1(q1290[3xV5::fzr-1]) II. |
| Description | Endogenous fzr-1 locus tagged with 3xV5 close to the N-terminus. Insertion site is a few amino acids downstream of start site (...PAN-3xV5-SPA…). Primer sequences to validate the strain: slc316 GCTTTTGCGTGTTCTCCTCA, slc317 TGAATCCTGAGTCATCATCCGAGT, WT product 347 bp, q1290[3xV5::fzr-1] product 485 bp. |
| Mutagen | Crispr/Cas9 |
| Outcrossed | x2 |
| Made by | Sarah Crittenden |
| Laboratory | JK |
| Reference | Not published. |
Sign in
or
register an account if you want to order this strain.