| HGA8002 |
C. elegans |
glp-1(e2141) III; lynEx1. Show Description
lynEx1 [(pJG01)nhr-80p::nhr-80::GFP + myo-2p::DsRed]. Sterile at 25C. Maintain at 20C or lower. Pick animals with red pharynx to maintain. Lifespan of animals carrying the array is longer than that of glp-1 alone. Reference: Goudeau J, et al. PLoS Biol. 2011 Mar;9(3):e1000599.
|
|
| HGA8004 |
C. elegans |
daf-16(mu86) I; glp-1(e2141) III; lynEx1. Show Description
lynEx1 [(pJG01)nhr-80p::nhr-80::GFP + myo-2p::DsRed]. Sterile at 25C. Maintain at 20C or lower. Pick animals with red pharynx to maintain. Lifespan of animals carrying the array is longer than that of daf-16; glp-1 double mutants. Reference: Goudeau J, et al. PLoS Biol. 2011 Mar;9(3):e1000599.
|
|
| HGA8005 |
C. elegans |
glp-1(e2141) III; daf-12(rh61rh411) X; lynEx1. Show Description
lynEx1 [(pJG01)nhr-80p::nhr-80::GFP + myo-2p::DsRed]. Sterile at 25C. Maintain at 20C or lower. Pick animals with red pharynx to maintain. Lifespan of animals carrying the array is longer than that of glp-1; daf-12 double mutants. Reference: Goudeau J, et al. PLoS Biol. 2011 Mar;9(3):e1000599.
|
|
| HMZ245 |
C. elegans |
ccar-1(sda11) IV. Show Description
Superficially wild-type except for a slightly shorter body length in adults. Crispr/Cas9 was used to create a 13 bp deletion in exon7 of ccar-1a; breakpoints: CTGATTCGGGAG/sda11/ATCGGAAGTTTC. sda11 is an isoform-specific deletion allele. It only affects the function of CCAR-1A and CCAR-1D, but not CCAR-1B and C. In addition, because CCAR-1D is not expressed in embryos,this allele can be used to specifically inactivate CCAR-1A (the full-length isoform that is the most similar to human CCAR1) during embryogenesis. Reference: Fu R, et al. J Cell Sci. 2018 May 10.
|
|
| HR505 |
C. elegans |
unc-59(e261) tba-2(sb51)/hIn1 [unc-54(h1040)] I. Show Description
Dominant temperature sensitive maternal-effect embryonic lethal. Maintain at 15C. Heterozygotes are WT. hIn1 homozygotes are Unc. Early cleavage spindles small and misoriented, cytokinesis often incomplete. Recessive non-temperature sensitive maternal-effect embryonic lethal (but sterile in conjuction with unc-59).
|
|
| HR592 |
C. elegans |
memi-1(sb41) dpy-20(e1282)/nT1 [unc-?(n754) let-?] IV; +/nT1 V. Show Description
Dominant ts maternal-effect embryonic lethal. Embryos show extensive cytoplasmic blebbing, often accompanied by small spindles and incomplete cytokinesis. Two cell embryos divide synchronously. Embryos arrest with eight to several hundred cells. Recessive non-ts maternal-effect embryonic lethal. Null may be WT. Maintain at 15C.
|
|
| HR83 |
C. elegans |
mel-24(ct59) dpy-20(e1282)/unc-24(e138) daf-15(m81) IV. Show Description
Heterozygotes are WT and segregate WT, Unc Dauers, and Dpys which throw dead eggs. Maintain by picking WT. ct59 animals are viable and fertile at 15C. ct59 is a temperature sensitive dominant maternal effect lethal. ct59 hets give more viable offspring at 15C than 25C.
|
|
| HS1204 |
C. elegans |
rmd-1&T05G5.9(tm1457) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Heterozygotes are green and segregate green WT, dead eggs and nonGreens that lay dead eggs with the defects in spindle organization, chromosome segregation, and cytokinesis.
|
|
| HT1881 |
C. elegans |
daf-16(mgDf50) I; daf-2(e1370) unc-119(ed3) III; lpIs12. Show Description
lpIs12 [daf-16a::RFP + unc-119(+)]. Maintain at 15C. Extended lifespan. Reference: Kwon ES, et al., Nature. 2010 Jul 22;466(7305):498-502.
|
|
| HT1882 |
C. elegans |
daf-16(mgDf50) I; daf-2(e1370) unc-119(ed3) III; lpIs13. Show Description
lpIs13 [daf-16b::CFP + unc-119(+)]. Maintain at 15C. Extended lifespan. Reference: Kwon ES, et al., Nature. 2010 Jul 22;466(7305):498-502.
|
|
| HT1883 |
C. elegans |
daf-16(mgDf50) I; daf-2(e1370) unc-119(ed3) III; lpIs14. Show Description
lpIs14 [daf-16f::GFP + unc-119(+)]. Maintain at 15C. Extended lifespan. Reference: Kwon ES, et al., Nature. 2010 Jul 22;466(7305):498-502.
|
|
| HT941 |
C. elegans |
lpIs1. Show Description
lpIs1 [jnk-1(+) + rol-6(su1006)]. Rollers. Over-expresses jnk-1(+) with rol-6. Shows life span extension. Integration of lpEx1.
|
|
| HT942 |
C. elegans |
lpIs2. Show Description
lpIs2 [jnk-1(+) + rol-6(su1006)]. Over-expresses jnk-1(+) with rol-6. Shows life span extension. Integration of lpEx1. Rollers.
|
|
| HW1822 |
C. elegans |
lin-29(xe61[lin-29::gfp::3xflag]) II Show Description
Low penetrance Pvl (i.e., tagged protein appears not fully functional). CRISPR/Cas9-engineered allele adds GFP and 3xflag tag to LIN-29. Do not distribute this strain; other labs should request it directly from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. Reference: Aeschimann F, et al., Mol Cell. 2017 Feb 2;65(3):476-489.
|
|
| HW1826 |
C. elegans |
lin-29(xe63[gfp::3xflag::lin-29a]) II. Show Description
Superficially wild-type. CRISPR/Cas9-engineered allele adds GFP and 3xflag tag to the N-terminus of LIN-29A. Do not distribute this strain; other labs should request it directly from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. Reference: Aeschimann F, et al., (2019). A single let-7 target to coordinate transition to adulthood. Life Science Alliance 2, e201900335. http://dx.doi.org/10.26508/lsa.201900335 )
|
|
| HW1835 |
C. elegans |
lin-29(xe40 xe65[lin-29b::gfp::3xflag]) II. Show Description
Partially penetrant Pvl and Egl. xe40 specifically disrupts the LIN-29A isoform. The GFP tag was inserted at the shared C-terminus of LIN-29A/B in the xe40 background, so only the labeled B isoform is expressed. Do not distribute this strain; other labs should request it directly from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. Reference: Pereira et al., (2019) Timing mechanism of sexually dimorphic nervous system differentiation. eLIFE 8: e42078. https://doi.org/10.7554/eLife.42078
|
|
| HZ455 |
C. elegans |
him-5(e1490) V; bpIs131. Show Description
bpIs131 [sepa-1p::sepa-1::GFP + unc-76(+)]. Him. SEPA-1::GFP aggregates form in a temporal pattern. Diffuse SEPA-1::GFP is detectible in most cells at the comma stage and greatly diminished by the 2-fold stage. After hatching, cytoplasmic SEPA-1::GFP aggregates were found in a few unidentified cells in the head and tail regions and also in the intestine, especially in the anterior and posterior pairs of intestine cells. Reference: Tian Y, et al. Cell. 2010 Jun 11;141(6):1042-55.
|
|
| HZ504 |
C. elegans |
him-5(e1490) V; bpIs37. Show Description
bpIs37 [dcap-1p::dcap-1::DsRed + rol-6(su1006)]. Rollers. Translational DsRed reporter for the P body-specific marker dcap-1, which encodes the C. elegans ortholog of decapping complex component DCAP1. Low levels of expression are homogenously distributed in the cytoplasm at all stages of embryogenesis. Reference: Sun YY, et al. Protein Cell. 2011 Nov;2(11):918-39.
|
|
| HZ771 |
C. elegans |
him-5(e1490) V; bpIs90. Show Description
bpIs90 [tia-1p::tia-1::GFP + rol-6(su1006)]. Rollers. Rolling phenotype is more apparent when raised >20C. TIA-1::GFP is homogenously distributed in the cytoplasm during embryogenesis. At larval stages, diffuse TIA-1::GFP signals are observed in seam cells and hypodermal cells. TIA-1::GFP forms distinct bodies, especially in seam cells and hypodermal cells, under stress conditions. Reference: Sun YY, et al. Protein Cell. 2011 Nov;2(11):918-39.
|
|
| IG1107 |
C. elegans |
sta-2(fr67) V; frIs7 IV. Show Description
frIs7 [nlp-29p::GFP + col-12p::DsRed] IV. Blocks inducible expression of antimicrobial peptide nlp-29 after D. coniospara infection or treatment with PMA. Maintain under normal conditions. Reference: Labed Sa, et al. PLoS One. 2012 7(3):e33887.
|
|
| IG1110 |
C. elegans |
snf-12(fr70) X; frIs7 IV. Show Description
frIs7 [nlp-29p::GFP + col-12p::DsRed] IV. Blocks inducible expression of antimicrobial peptide nlp-29 after D. coniospara infection or treatment with PMA. Maintain under normal conditions. Reference: Labed Sa, et al. PLoS One. 2012 7(3):e33887.
|
|
| IG1114 |
C. elegans |
snf-12(fr74) X; frIs7 IV. Show Description
frIs7 [nlp-29p::GFP + col-12p::DsRed] IV. Blocks inducible expression of antimicrobial peptide nlp-29 after D. coniospara infection or treatment with PMA. Maintain under normal conditions. Reference: Labed Sa, et al. PLoS One. 2012 7(3):e33887.
|
|
| IG113 |
C. elegans |
frP1 III. Show Description
Mos1 transposon insertion: F28F5 (at position 1023) acacctggtaCTCACCCCTGTTTAACACACAGTCTTCACA. Mos1 sequence is in lowercase.
|
|
| IG114 |
C. elegans |
frP2 III. Show Description
Mos1 transposon insertion: T28A8 (at position 2841) acacctggtaTTAAGAAAAAAACCGAGTCCTCTCACCGTA. Mos1 sequence is in lowercase.
|
|
| IG115 |
C. elegans |
frP3 V. Show Description
Mos1 transposon insertion: CO8D8 (at position 17534) acacctggtaATAAAAGAAGGAAAAATAAATATTTAAGTT. Mos1 sequence is in lowercase.
|
|
| IG117 |
C. elegans |
frP41 IV. Show Description
Mos1 transposon insertion: Y38C1AB (at position 8906) acacctggtaCAACTGGTTTAGAATAATTTAGAAATTACAA. Mos1 sequence is in lowercase.
|
|
| IG118 |
C. elegans |
frP5 V. Show Description
Mos1 transposon insertion: F57F4 (at position 15459) acacctggtaGTCTCTTCAAGGAAGAACAATGAGAAATAA. Mos1 sequence is in lowercase.
|
|
| IG119 |
C. elegans |
frP7 IV; frP6 X. Show Description
Mos1 transposon insertion: frP6: F39H12 (at position 19268) acacctggtaAGCATAGGGCTAGGCCTTAGACTTTATATT, and frP7: Y10G11A (at position 1294) acacctggtaAAACAATTTCCAAGTAAAAAAATCATGTATT. Mos1 sequence is in lowercase.
|
|
| IG122 |
C. elegans |
frP8 frP9 III. Show Description
Mos1 transposon insertion: frP8: H14A12 (at position 9047) acacctggtaTACAATTTTGATTTCAGAAAGTTCTCTGAC, and frP9: Y45F3A (at position 220) acacctggtaGAATTGTTCGAACAAGCTTCAACGAGAAAGCAA. Mos1 sequence is in lowercase.
|
|
| IG123 |
C. elegans |
frP10 X. Show Description
Mos1 transposon insertion: B0272 (at position 11068) acacctggtaTATGAGAAAATCTATAGCAAGTACATATCT. Mos1 sequence is in lowercase.
|
|
| IG124 |
C. elegans |
frP11 I; frP13 II; frP14 III; frP12 X. Show Description
Mos1 transposon insertions: frP11: F31C3 (at position 26364) acacctggtaTCGGAGGAGCTGCCAAATGGCGTCCGACTT. frP12: F01E11 (at position 3748) acacctggtaCAATCGAAAATCATTGAAATCAGTTAACAG. frP13: Y38E10A (at position 40384) acacctggtaTAGCTAGAGGACTGTCCCGGTCTAAAATGA. frP14: F53A2 (at position 34332) acacctggtaTATTATAAAAGATGTATGAAATGTCGTGAA. Mos1 sequence is in lowercase.
|
|
| IG125 |
C. elegans |
frP15 IV. Show Description
Mos1 transposon insertion: Y97E10B (at position 1022) acacctggtaAAACATGCTGAAAGTTTACTAAAATTGAAT. Mos1 sequence is in lowercase.
|
|
| IG126 |
C. elegans |
frP16 III. Show Description
Mos1 transposon insertion: Y39A3CL (at position 24032) acacctggtaTATCGAAAAAAAATTTTTTTTTGGAATTTT. Mos1 sequence is in lowercase.
|
|
| IG127 |
C. elegans |
frP17 IV. Show Description
Mos1 transposon insertion: K07H8 (at position 8196) acacctggtaTTATCAAAGTTAGAATTCAAACTGCGTTGC. Mos1 sequence is in lowercase.
|
|
| IG128 |
C. elegans |
frP20 frP19 II; frP18 V. Show Description
Mos1 transposon insertions: frP18: K03H4 (at position 19156) acacctggtaGAATGGATGAGGTTGAAAGTGACGAAGAAAA. frP19: F35H8 (at position 15891) acacctggtaGTTTACTCATATTTCTTTCCTCTCTTCTTC. frP20: T14B4 (at position 25648) acacctggtaTGCAAATATGGTTAATGTAAGGCATTTTTG. Mos1 sequence is in lowercase.
|
|
| IG129 |
C. elegans |
frP21 IV. Show Description
Dumpy. Mos1 transposon insertion: F30B5 (at position 22345) (dpy-13) acacctggtaGTTGTAGACGATTGGAAGAGTAATGCAAAC. Mos1 sequence is in lowercase.
|
|
| IG1352 |
C. elegans |
nipi-4(fr71) V; frIs7 IV. Show Description
frIs7 [nlp-29p::GFP + col-12p::DsRed] IV. Blocks inducible expression of antimicrobial peptide nlp-29 after D. coniospara infection or treatment with PMA. Maintain under normal conditions. Reference: Labed Sa, et al. PLoS One. 2012 7(3):e33887.
|
|
| IG1839 |
C. elegans |
frSi17 II; frIs7 IV; rde-1(ne300) V. Show Description
frSi17 [mtl- 2p::rde-1 3'UTR] II. frIs7 [nlp-29p::GFP + col-12p::DsRed] IV. frSi17 inserted into ttTi5605 site using CRISPR/Cas9 engineering. RDE-1 activity is rescued in the intestine, making animals RNAi-deficient except for intestinal tissues. The frSi17 insertion can be detected using a primer within the mtl-2 promoter (jep1061: aacaaacgtgggatgtaacc) in combination with downstream primer in rde-1 (jep2817 tcatactcgtagtattcccg), producing a 786 bp product if insertion is present. rde-1(ne300) can be genotyped by sequencing the PCR product from jep2299: gaacaacgacaatcgagcacca and jep3108: ATcttgtgaccgaactgtcc. (jep3108 is not present in the frSi17 transgene) Reference: Watts JS, et al. G3 (Bethesda) 2020 Nov 5;10(11):4167-4176. PMID: 32943454
|
|
| IG1846 |
C. elegans |
frSi21 II; frIs7 IV; rde-1(ne300) V. Show Description
frSi21 [col-62p::rde-1 3'UTR] II. frIs7 [nlp-29p::GFP + col-12p::DsRed] IV. frSi21 inserted into ttTi5605 site using CRISPR/Cas9 engineering. RDE-1 activity is rescued in adult epidermal tissues, making animals RNAi-deficient except for hypodermal (skin) tissues from the young adult stage. The frSi21 insertion can be detected using a primer within the col-62 promoter (jep2245: caaaaaggcgggatgagcag) in combination with downstream primer in rde-1 (jep2817 tcatactcgtagtattcccg), producing a 965 bp product if insertion is present. rde-1(ne300) can be genotyped by sequencing the PCR product from jep2299: gaacaacgacaatcgagcacca and jep3108: ATcttgtgaccgaactgtcc (jep3108 is not present in the frSi21 transgene). Reference: Watts JS, et al. G3 (Bethesda) 2020 Nov 5;10(11):4167-4176. PMID: 32943454
|
|
| IG2212 |
C. elegans |
spia-1(fr201[spia-1::mNG(internal)::3xFLAG] X. Show Description
Internal mNeonGreen::3xFLAG tags inserted into endogenous spia-1 locus.
|
|
| IG274 |
C. elegans |
frIs7. Show Description
frIs7 [nlp-29p::GFP + col-12p::DsRed] IV. The nlp-29p::GFP reporter is induced in the epidermis upon infection with Drechmeria coniospora, wounding and osmotic stress. Reference: Pujol N, et al. Curr Biol. 2008 Apr 8;18(7):481-9.
|
|
| IG339 |
C. elegans |
tpa-1(fr1) frIs7 IV. Show Description
frIs7 [nlp-29p::GFP + col-12p::DsRed] IV. Displays tpa-1 phenotypes (e.g. resistance to PMA). Isolated in a genetic screen for mutants failing to show an induction of nlp-29p::GFP reporter gene expression upon infection with the fungus Drechmeria coniospora (the Nipi phenotype). References: Pujol N, et al. Curr Biol. 2008 Apr 8;18(7):481-9. Ziegler K, et al. Cell Host Microbe. 2009 Apr 23;5(4):341-52.
|
|
| IG341 |
C. elegans |
tpa-1(fr3) frIs7 IV. Show Description
frIs7 [nlp-29p::GFP + col-12p::DsRed] IV. Displays tpa-1 phenotypes (e.g. resistance to PMA). Isolated in a genetic screen for mutants failing to show an induction of nlp-29p::GFP reporter gene expression upon infection with the fungus Drechmeria coniospora (the Nipi phenotype). References: Pujol N, et al. Curr Biol. 2008 Apr 8;18(7):481-9. Ziegler K, et al. Cell Host Microbe. 2009 Apr 23;5(4):341-52.
|
|
| IG444 |
C. elegans |
frEx113. Show Description
frEx113 [(pJL44) transposase + col-12p::DsRed]. Should be grown at 25C. Reference: Vallin E, et al. PLoS One. 2012;7(2):e30482.
|
|
| IJ1651 |
C. elegans |
mdt-15(yh44[mdt-15::AID*::EmGFP]) III. Show Description
AID* and EmGFP tag inserted at the 3' end of the endogenous mdt-15 gene locus by CRISPR/Cas9 engineering. This strain can be used for auxin-inducible degradation (AID) of MDT-15 protein. Reference: Lee D, et al. PLoS Biol. 2019 Aug 13;17(8):e3000415. doi: 10.1371/journal.pbio.3000415. PMID: 31408455.
|
|
| IK589 |
C. elegans |
ttx-7(nj50) I. Show Description
Putative null allele which lacks whole of the first exon of the gene (lacking 361 bp area corresponding to 13460-13820 of the cosmid F13G3). Severe thermotaxis defect. Weak defects in chemitaxis. Subcellular localization of synaptic proteins is abnormal in RIA interneurons.
|
|
| IK591 |
C. elegans |
ttx-7(nj51) I. Show Description
Putative null allele which lacks whole of the 3rd exon of the gene (lacking 260 bp area corresponding to 12984-13243 of the cosmid F13G3). Severe thermotaxis defect. Weak defects in chemitaxis. Subcellular localization of SNB-1::GFP is abnormal in RIA interneurons.
|
|
| IK637 |
C. elegans |
sax-7(nj53) IV. Show Description
nj53 is a SAX-7 long-form-specific deletion mutant. nj53 shos the normal neuronal position phenotype.
|
|
| IP1001 |
C. elegans |
nhr-6(lg6001)/qC1 [dpy-19(e1259) glp-1(q339)] III. Show Description
Homozygous nhr-6(lg6001) mutants have defective spermatheca development causing low brood size, abnormally shaped eggs, and occasional Egl. Heterozygotes are WT and segregate WT, semi-sterile WT, and Sterile Dpys.
|
|
| IW412 |
C. elegans |
tax-2(gk117937) I. Show Description
Maintain at 20C. Improved survival at 37C. Dauer constitutive and longer lifespan at 28C. Reference: Hwang HY, et al. Front Genet. 2020 Oct 6;11:566948. doi: 10.3389/fgene.2020.566948. PMID: 33133151
|
|