More Fields
Strain Species Genotype
JK6251 C. elegans apx-1(q1148[apx-1::3xV5]) V. Show Description
3xV5 tag inserted at C-terminus of endogenous apx-1 locus. APX-1 guide: GACTCGTCATCTGCTGCCATCGG. APX-1 3xV5 repair with mutation (197 nt): CCTATGGCAGCAGATGACGAGTCGTCGTTTCGAGTCGGTAAGCCTATCCCTAACCCTCTCCTCGGTCTAGATAGTACTGGAAAGCCAATCCCAAACCCACTCCTCGGACTTGATAGCACCGGTAAGCCTATCCCTAACCCACTCCTCGGACTTGATAGCACCTAAACAACAGCTCGACGACGAGATTTACAATAATT.