Search Strains

oxIs322 [myo-2p::mCherry::H2B + myo-3p::mCherry::H2B + Cbr-unc-119(+)] II. ccTi1594 [mex-5p::GFP::gpr-1::smu-1 3'UTR + Cbr-unc-119(+), III: 680195] III. mCherry expression in pharyngeal and body wall muscle nuclei. GFP expression in germline. High penetrance of non-Mendelian inheritance. The GPR-1 overexpression transgene consistently confers a high penetrance of non-Mendelian inheritance; fluorescent markers allow tracking of Mendelian and non-Mendelian events. The genomic location of ccTi1594 is with respect to the WEBcel235 assembly.

Green body muscle filaments, slightly sluggish movement. Functional translational fusion that provides a means to observe striated muscle thick filaments in real time. Reference: Nature. 2016 Jun 30;534(7609):719-23.

Endogenous unc-54::GFP made by CRISPR. Exhibits green thick muscle filaments in the body wall muscle. Weakly Unc. Reference: Arribere JA, Cenik ES, Jain N, Hess GT, Lee CH, Bassik MC, Fire AZ. Translation readthrough mitigation. Nature. 2016 Jun 30;534(7609):719-23. Epub 2016 Jun 1.

ccIs4251 [(pSAK2) myo-3p::GFP::LacZ::NLS + (pSAK4) myo-3p::mitochondrial GFP + dpy-20(+)] I. This strain produces GFP in all body wall muscles and vulval muscles, with a combination of mitochondrial and nuclear localization. ME0. Heterozygous males mate well. Integrated array (ccIs4251) contains 3 plasmids: pSAK2 (myo-3 promoter driving a nuclear-targeted GFP-LacZ fusion), pSAK4 (myo-3 promoter driving motochondrially targeted GFP), and a dpy-20 subclone. Array rescues dpy-20(e1282ts).

ayIs2 [egl-15p::GFP + dpy-20(+)] IV. Adult midbody GFP pattern in 8 vm-1 type muscles (instead of 4 as in WT). mls-1(o) converts uterine to vulval muscles.

ccIs56 [sup-7(st5) +unc-54::lacZ] V. Non-nuclear unc-54::lacZ fusion expressed in nuclei and cytoplasm of body wall muscles.

feIs4 [sur-5p::luciferase::GFP + rol-6(su1006)] V. pkIs2386 [unc-54p::alphasynuclein::YFP + unc-119(+)]. alphasynuclein::YFP is localized throughout the body-wall muscle cells. Rollers. Strain is bioluminescent when provided with exogenous D-luciferin (potassium salt) due to sur-5 promoter driving expression of firefly (Photinus pyralis) luciferase (lacking the peroxisome tagging signal) fused in-frame to GFP(S65C). Pick animals with high levels of fluorescence to retain expression of luciferase transgene. This strain is for academic use only. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. References: Lagido C, et al. BMC Physiol. 2008 Apr 2;8:7. McLaggan D, et al. PLoS One. 2012;7(10):e46503. Lagido C, et al. Toxicol Sci. 2009 May;109(1):88-95.

feIs5 [sur-5p::luciferase::GFP + rol-6(su1006)] X. pkIs2386 [unc-54p::alphasynuclein::YFP + unc-119(+)]. alphasynuclein::YFP is localized throughout the body-wall muscle cells. Rollers. Strain is bioluminescent when provided with exogenous D-luciferin (potassium salt) due to sur-5 promoter driving expression of firefly (Photinus pyralis) luciferase (lacking the peroxisome tagging signal) fused in-frame to GFP(S65C). Pick animals with high levels of fluorescence to retain expression of luciferase transgene. This strain is for academic use only. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. References: Lagido C, et al. BMC Physiol. 2008 Apr 2;8:7. McLaggan D, et al. PLoS One. 2012;7(10):e46503. Lagido C, et al. Toxicol Sci. 2009 May;109(1):88-95.

mCherry tag inserted into the endogenous ikb-1 locus. IKB-1::mCherry is observed in the pharynx and body wall muscles during development. No obvious phenotype. Reference: Brena D, et al. Sci Rep. 2020 Sep 30;10(1):16153.

CRISPR/Cas9 engineered tagged endogenous locus. Reference: Reilly MB, et al. Widespread employment of conserved C. elegans homeobox genes in neuronal identity specification. bioRxiv 2022.04.29.490095; doi: https://doi.org/10.1101/2022.04.29.490095

CRISPR/Cas9 engineered tagged endogenous locus. Reference: Reilly MB, et al. Widespread employment of conserved C. elegans homeobox genes in neuronal identity specification. bioRxiv 2022.04.29.490095; doi: https://doi.org/10.1101/2022.04.29.490095

CRISPR/Cas9 engineered tagged endogenous locus. Reference: Reilly MB, et al. Widespread employment of conserved C. elegans homeobox genes in neuronal identity specification. bioRxiv 2022.04.29.490095; doi: https://doi.org/10.1101/2022.04.29.490095

CRISPR/Cas9 engineered tagged endogenous locus. Reference: Reilly MB, et al. Widespread employment of conserved C. elegans homeobox genes in neuronal identity specification. bioRxiv 2022.04.29.490095; doi: https://doi.org/10.1101/2022.04.29.490095

Significant depletion of serotonin and serotonin-derived metabolites; increase in exploration. Double mutant created by CRISPR-mediated deletion of 1450 bp spans Exon 1 to Exon 6 (the same deletion as syb3601 in PHX3601) in tph-1 background. Upstream flanking sequence: cctctgaaaaccaaatcttgttctctgaaa; Downstream flanking sequence: TCGCTGGTCTTCTTTCTTCTCGTGATTTCT.

Superficially wild-type; decreased production of serotonin-derived metabolites; increase in exploration. CRISPR-mediated deletion removing 1450 bp spans Exon 1 to Exon 6. Upstream flanking sequence: cctctgaaaaccaaatcttgttctctgaaa; Downstream flanking sequence: TCGCTGGTCTTCTTTCTTCTCGTGATTTCT.

GFP tag inserted into endogenous fat-6 locus using Crispr/Cas9. fat-6::GFP expression in intestine and hypodermis. No obvious phenotype, but the fat-6 locus is likely inactive in this strain. Reference: Bodhicharla R, et al. Genetics. 2018 Sep;210(1):189-201.

CRISPR/Cas9-engineered 5421 bp deletion entirely removing both hlh-17 and hlh-31. Reference: Aguilar GR, et al. PLoS Biol. 2025 Jan 6;23(1):e3002979. doi: 10.1371/journal.pbio.3002979. PMID: 39761329

Shorter body length. Reference: Bennett DF, et al. Aging Cell. 2023 Feb;22(2):e13774. doi: 10.1111/acel.13774. PMID: 36670049.

sybIs62 [NISH-1::EGFP::3xFLAG + unc-119(+) + myo-2p::mCherry]. Transgene rescues nish-1(syb767) rilemenidine-induced longevity, rilemenidine-induced heat resistance, and rilemenidine-induced healthspan (body bends). Reference: Bennett DF, et al. Aging Cell. 2023 Feb;22(2):e13774. doi: 10.1111/acel.13774. PMID: 36670049.

iwIs16 [act-4::lacZ] X. Maintain at 15C. Temperature-sensitive dauer constitutive. 100% dauer formation at 25C; poor dauer recovery at 15C. Maternal effect. Good lacZ expression in spermatheca, but weak in body wall.

ccIs55 [unc-54::lacZ + sup-7(st5)] V. Small body size. Slow growth. Strong lacZ staining in body wall.

ccIs55 [unc-54::lacZ + sup-7(st5)] V. Small body size, slow growth. Strong lacZ staining in body wall.

ccIs55 [unc-54::lacZ + sup-7(st5)] V. Small body size. Slow growth. Strong lacZ staining in body wall.

ccIs55 [unc-54::lacZ + sup-7(st5)] V. Maintain at 15C. Leaky dauer constitutive -- ~95% dauer formation at 25C. Small body size at 20C. Strong lacZ staining in body wall at 15C; no staining at 25C.

ccIs55 [unc-54::lacZ + sup-7(st5)] V. Maintain at 15C. daf-4 is temperature-sensitive and dauer formation (not body size) phenotype is suppressed by daf-3. Dauers will form only when plates are crowded, starved, and maintained at 26C. Animals are small at 25C.

Heterozygotes are WT and segregate WT, paralyzed Dpys, and Uncs which are sterile (with 1-2 escaper progeny). ptc-1 homozygotes have multinucleate germ cells (both sperm and oocytes). ptc-1 homozygotes have an underproliferated germline.

3xHA::TurboID tag with GGCG linker sequence inserted at the N-terminus of the endogenous NHR-49 gene (long isoform c). Derived by out-crossing parental strain PHX10203. Reference: Tatge L & Douglas PM. MicroPubl Biol. 2025 Aug 1. doi: 10.17912/micropub.biology.001655.

Defective in chemotaxis to Na+, NaHCO3, pyridine, cAMP, D-tryptophan; partially defective to CO2(phosphate)m H+(phosphate),, H+(citrate); inverted taxis to Cl-, OH-. Progeny yield about 50% of normal. No Thermotaxis. See also WBPaper00002585.

Male-female strain. Gonochoristic. Grows well on OP50. Freezes well with C. elegans protocol. Isolated by Robin Giblin-Davis in October 1990 in Dade County, FL in the abdomen of an adult female of Metamasius hemipterus. Consult Walter Sudhaus or Robin Giblin-Davis for appropriate taxonomy before publication. Do not distribute this strain; other labs should request it from the CGC. sp. 3 in Kiontke and Sudhaus Wormbook Ecology chapter.

Transformation of ray 6 to a thin ray which is anteriorly displaced and fuses with ray 4 (95%). A 10th ray is found in about 50% of the sides scored. Body is slightly shorter. Do not distribute this strain; other labs should request it from the CGC.

syEx1343 [myo-3p::fars-1(T412G)::fib-1::rps-16::GFP(S65C, SynIVS)::unc-54 3' UTR + myo-2p::DsRed::unc-54 3' UTR + pha-1(+) + pBluescript]. GFP expression in body wall muscle. Maintain at 25C and pick animals with red fluorescence in pharynx. Expresses a phenylalanyl-tRNA capable of tagging proteins with the non-canonical amino acid p-azido-L-phenylalanine in body wall muscle. Reference: Yuet KP, et al. Proc Natl Acad Sci U S A. 2015 Mar 3;112(9):2705-10.

syIs321 [myo-3p::NLS::GAL4SK::VP64::unc-54 3'UTR + myo-2p::NLS::mCherry + pBlueScript].  myo-3 cGAL driver for body wall muscle.  Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148.

Bacteria. E. coli harboring the plasmid PB255, which uses the lin-31 promoter variant to express the lin-31::VP16 chimeric gene. It is particularly useful for the expression of heterologous genes in the vulval precursor cells. PB255 possesses three main components : an enhancer, a promoter region, a multi-cloning site (MCS), and a 3' UTR derived from the unc-54 gene. [CGC note: The plasmid in this strain was constructed from pBS II KS(+) and is likely Amp-R, but Amp-R has not been confirmed]. Biosafety Level: BSL-1.

Isolated at Devil's Lake State Park, Lincoln City, OR. Off a path about 200 feet from a dock in wet, organic topsoil in a forest.

fxSi3 [hsp-16.41p::PEEL-1::tbb-2 3' UTR + rpl-28p::mKate2::unc-54 3'UTR + rps-0p::HygR::unc-54 3' UTR, I:2851003] I. fxSi4 [hsp-16.41p::PEEL-1::tbb-2 3'UTR + loxP, II: 8420157] II. Heat-shock strain can be maintained at 20C without any issues. Degron tag was inserted into the endogenous spe-44 locus, allowing auxin-inducible spermatogenesis arrest and reversible male sterility. Heat-shock-induced expression of PEEL-1 will cause lethality in both sexes. Five generations of lab adaptation following genome editing, all in the CB4856 background. Reference: Kasimatis, KR et al. (2021) Post-Insemination Selection Dominates Pre-Insemination Selection in Driving Male Competitive Ability. bioRxiv doi: https://doi.org/10.1101/2021.06.23.449605

fxSi1 [pie-1p::TIR-1::mRuby::unc-54 3' UTR + loxP, I: 2851003] I. fxSi4 [hsp-16.41p::PEEL-1::tbb-2 3'UTR + loxP, II: 8420157] II. fxSi6 [hsp-16.41p::PEEL-1::tbb-2 3' UTR + rpl-28p::mKate2::unc-54 3'UTR + rps-0p::HygR::unc-54 3' UTR, III: 10158855] III. Heat-shock strain can be maintained at 20C without any issues. Degron tag was inserted into the endogenous spe-44 locus, allowing auxin-inducible spermatogenesis arrest and reversible male sterility. Heat-shock-induced expression of PEEL-1 will cause lethality in both sexes. fxSi4 was originally inserted in a CB4845 background, but has been sufficiently backcrossed so that PX658 is >98.5% JU2526 genetic background. Reference: Kasimatis, KR. et al. (2021) Post-Insemination Selection Dominates Pre-Insemination Selection in Driving Male Competitive Ability. bioRxiv doi: https://doi.org/10.1101/2021.06.23.449605

kyIs104 [str-1::GFP]. AWB expression of GFP. mef-2 suppresses the phenotypes of kin-29 (small body size, hypersensitivity to dauer pheromone, reduced expression of the str-1 chemoreceptor in the AWB olfactory neurons). WT looking.

kyIs104 [str-1::GFP]. AWB expression of GFP. hda-4 suppresses the phenotypes of kin-29 (small body size, hypersensitivity to dauer pheromone, reduced expression of the str-1 chemoreceptor in the AWB olfactory neurons). WT looking.

kyIs104 [str-1::GFP]. AWB expression of GFP. mef-2 suppresses the phenotypes of kin-29 (small body size, hypersensitivity to dauer pheromone, reduced expression of the str-1 chemoreceptor in the AWB olfactory neurons). WT looking.

etIs1 [ric-19p::ric-19::GFP + rol-6(su1006). Low levels of ric19::GFP fusion protein expression driven by the ric-19 promoter in all neurons except for strong expression in the pharyngeal M2 neurons. About 30% of worms have defects in the distal ends of the pharyngeal M2 neurons.

etIs1 [ric-19p::ric-19::GFP + rol-6(su1006). Low levels of ric19::GFP fusion protein expression driven by the ric-19 promoter in all neurons except for strong expression in the pharyngeal M2 neurons. 10% of the worms have a pharyngeal M2 neuron cell body misplaced into the metacarpus.

Male/Female, maintain by mating. Isofemale line isolated from a rotting fruit at the Botanical Garden in Kolonia, Pohnpei, Micronesia (), December 2023. Gonochoristic species in the Japonica Group. Reference: Rockman M, et al. 2024. New species from Pohnpei, Micronesia. In preparation.

mcIs50 [lin-26p::vab-10(actin-binding domain)::GFP + myo-2p::GFP + pBluescript]. Variably Abnormal with body shape defects and bobbed tail at all stages. Reference: Vuong-Brender TTK, et al. PLoS One. 2018 Feb 21;13(2):e0193279.

Mitani Laboratory allele. Gro, Maternal-effect, diet/nutrition-dependent embryonic lethal. Strain segregates near 100% lethality when grown on glucose, UV-treated OP50, older OP50, and DA837. Lethality is suppressed on fresh OP50 (less than 5 days from seeding), HB101, and HT115.

zjEx53 [gst-4p::tdTomato::unc-54 3'UTR]. Pick bright tdTomato to maintain the array. Worms with zjEx53 express tdTomato strongly throughout the body. Small and slow-growing with strong constitutive activation of SKN-1 and downstream detoxification genes. References: Choe KP, et al. Mol Cell Biol. 2009 May;29(10):2704-15. doi: 10.1128/MCB.01811-08. PMID: 19273594. Tang L, et al. Mech Ageing Dev. 2015 Jul;149:88-98. doi: 10.1016/j.mad.2015.06.001. PMID: 26056713.

zfIs149 [flp-18p(3kb)::mCherry::SL2::FLP-18 + lin-15(+)] X. FLP-18 expressing neurons are labeled with cytosolic mCherry. Overexpression of FLP-18 causes uncoordinated locomotion. Animals exhibit exaggerated head and body bends, increased reversal frequency, and enhanced calcium transients in body-wall muscle. These phenotypes are suppressed by loss of NPR-5. Reference: Florman JT & Alkema MJ. PLOS Genet. 2022 Mar 3;18(3):e1010091. doi: 10.1371/journal.pgen.1010091. PMID: 35239681.

B0348.4a Homozygous. Outer Left Sequence: ACATCCGGAGCTAAAGCAGA. Outer Right Sequence: CGCCGAGAAAGCAATAGAAC. Inner Left Sequence: TGCTACCTATTGGGTTTCGG. Inner Right Sequence: TGGCCGAGTTTTCTCATCTC. Inner Primer PCR Length: 2928. Estimated Deletion Size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C49C3.1 Homozygous. Outer Left Sequence: CTATTGTCAGGGACTCGGGA. Outer Right Sequence: TGACATGTTTCCACGGCTTA. Inner Left Sequence: CTGGAGATTTCCGACGAGAG. Inner Right Sequence: CGGGGGTATAGTGGGCTAAT. Inner Primer PCR Length: 3002. Estimated Deletion Size: about 1800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C14F5.3 Homozygous. Outer Left Sequence: AGCGGGATCAATTCCTTTCT. Outer Right Sequence: TATGCAACGTCTTTTGGCAG. Inner Left Sequence: CGGATGCGTTTGGTATTTCT. Inner Right Sequence: TCATTCGGGAGGAACGATAC. Inner Primer PCR Length: 3234. Estimated Deletion Size: about 1400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

M04G12.3 Homozygous. Outer Left Sequence: GAGCTACCGCTCCACTTTTG. Outer Right Sequence: CGAGCAACTTGAAACGATGA. Inner Left Sequence: AAGTTTTCAGCTTCTGGGCA. Inner Right Sequence: TGAGCCATGCGAGTATGAAG. Inner Primer PCR Length: 3062. Estimated Deletion Size: about 1600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807