| AV311 |
C. elegans |
dpy-18(e364) unc-3(e151) meT7 (III;X;IV). Show Description
Dpy. Unc. meT7 is an end-to-end-to-end fusion of chromosomes III, X, and V. The right end of III is fused to the left end of X, and the right end of X is fused to the left end of IV. Constructed by crossing eT5 and mnT12. meT7 homozygotes produce 92% viable progeny. meT7 heterozygotes are Him and produce many dead eggs. |
|
| CB6121 |
C. elegans |
eT5 (X; III); fog-2(q71) V females and eT5 (X; III) / eT1(III; V); fog-2 / eT1 (fog-2 V; III) males Show Description
Male/female strain, propagate by crossing. Females are eT5 (III;X); fog-2(q71) V. Males are eT5 (III;X) / eT1(III;V); fog-2 / eT1 (fog-2 III;V). Strain with multichromosomal sex determination. Reference: Strain 21 in Hodgkin (2002) PMID: 12399387. |
|
| QC105 |
C. elegans |
etIs2 III; ten-1(et5) X. Show Description
etIs1 [ric-19p::ric-19::GFP + rol-6(su1006). Low levels of ric19::GFP fusion protein expression driven by the ric-19 promoter in all neurons except for strong expression in the pharyngeal M2 neurons. 10% of the worms have a pharyngeal M2 neuron cell body misplaced into the metacarpus. |
|
| ET507 |
C. elegans |
daf-16(mu86) I; cki-2(ok2105) II; glp-1(ar202) III. Show Description
Temperature-sensitive. Maintain at 15C. Animals form germline tumors that prevent fertility at restrictive temerature (25C). This is the first strain reported to be used for the isolation of germ cells for in vitro culture. This strain allows germ cells to remain viable for longer periods than other tumorous mutant strains tested. Reference: Chaudhari SH, et al. Dev Cell. 2016 Jul 11;38(1):33-46. |
|
| NJF01 |
Escherichia coli |
NJF01 (F-, lambda- lysA0::Tn10 IN(rrnD-rrnE)1, DE3, (delta)rnc-38). Show Description
Bacteria. NJF01 originates from E. coli ET505 (F-, lambda- lysA0::Tn10 IN(rrnD-rrnE)1), modified with DE3 and (delta)rnc-38. The E. coli is lysine auxotroph and resistant to kanamycin and tetracycline. IPTG induces expression of the T7 polymerase. Grow at 37 °C on LA plates or in LB liquid medium. Reference: Fredens J, et al. Nat Methods. 2011 Aug 28;8(10):845-7. |
|
| QC156 |
C. elegans |
acs-13(et54) nhr-49(et8) I; mdt-15(et14) III. Show Description
This triple mutant strain contains an excess polyunsaturated fatty acids in its cell membranes accompanied by excess lipid peroxidation, cell permeability, increased autophagy and other defects. The acs-13(et54) mutation (G125R) can be detected using PCR with the following primers: WT FWD: 5´CTA CCA GGG TGT TCG CCA TG 3; acs-13 mutant FWD: 5´CTA CCA GGG TGT TCG CCA TA 3; acs-13 REV: 5´TCA AAC TTG GGC ATT GCT CC 3´. Annealing 65°C, expected product 395 bp. The nhr-49(et8) C9873765T [WS200] mutation can be detected by PCR using the following primers: nhr-49 Fwd: 5’-CAGATTATGATTCGTGATGCTAGA-3; nhr-49 WT Rev: 5’-GAGATGAAAGATGTTGCTGTAGAG-3; nhr-49 Mut Rev: 5’-GAGATGAAAGATGTTGCTGTAGAA-3’. Annealing 65°C, expected products ~300 bp. The mdt-15(et14) C5832666T [WS200] mutation can be detected by PCR using the following primers: mdt-15(et14) Mut Fwd: 5’-GTGCCTCCAGATCCACAGCT-3’; mdt-15(et14) WT Fwd: 5’-GTGCCTCCAGATCCACAGCC-3’; mdt-15 Rev: 5’-CACCCATTGGAGCACCACT-3’. Annealing 65°C, expected product ~400 bp. Reference: Devkota R, et al. Genetics (in press). Volume 219, Issue 1, September 2021. https://doi.org/10.1093/genetics/iyab093 |
|
| QC158 |
C. elegans |
paqr-1(et52) IV. Show Description
paqr-1 gain-of-function allele. R109C amino acid substitution isolated in a paqr-2(tm3410) suppressor screen. PCR genotyping can be done with these primers: paqr-1 seq REV: TTTCCGTGTGCAGTGACCA; paqr1_WT_REV: TGCCCTCCCTTTTTACGGCG; paqr1_mut_REV: TGCCCTCCCTTTTTACGGCA. This yields a 441 bp product. Reference: Busayavalasa K, et al. PLoS Genet. 2020 Aug 4;16(8):e1008975. PMID: 32750056 |
|