Strain Information
| Name | PHX3601 View On Wormbase |
|---|---|
| Species | C elegans |
| Genotype | pah-1(syb3601) II. |
| Description | Superficially wild-type; decreased production of serotonin-derived metabolites; increase in exploration. CRISPR-mediated deletion removing 1450 bp spans Exon 1 to Exon 6. Upstream flanking sequence: cctctgaaaaccaaatcttgttctctgaaa; Downstream flanking sequence: TCGCTGGTCTTCTTTCTTCTCGTGATTTCT. |
| Mutagen | No mutagen |
| Outcrossed | x0 |
| Made by | Frank Schroeder via SUNY Biotech |
| Laboratory | OH |
| Reference | Publication currently in revision. |
Sign in
or
register an account if you want to order this strain.