Strain Information
| Name | PHX3596 View On Wormbase |
|---|---|
| Species | C. elegans |
| Genotype | tph-1(mg280) pah-1(syb3596) II. |
| Description | Significant depletion of serotonin and serotonin-derived metabolites; increase in exploration. Double mutant created by CRISPR-mediated deletion of 1450 bp spans Exon 1 to Exon 6 (the same deletion as syb3601 in PHX3601) in tph-1 background. Upstream flanking sequence: cctctgaaaaccaaatcttgttctctgaaa; Downstream flanking sequence: TCGCTGGTCTTCTTTCTTCTCGTGATTTCT. |
| Mutagen | No mutagen |
| Outcrossed | x0 |
| Made by | Frank Schroeder via SUNY Biotech |
| Laboratory | OH |
| Reference | Publication currently in revision |
Sign in
or
register an account if you want to order this strain.