| DR1369 |
C. elegans |
sma-4(e729) III. Show Description
Short, non-Dpy. Males have crumpled spicules.
|
|
| FK412 |
C. elegans |
sma-4(e729) III; sma-5(n678) X. Show Description
Very small. Small brood size (about 1/10 that of WT). Grows very slowly. Line A. Reference: Watanabe, N et al. Genes to Cells 2007. 12(5):603-609.
|
|
| FK413 |
C. elegans |
sma-4(e729) III; sma-5(n678) X. Show Description
Very small. Small brood size (about 1/10 that of WT). Grows very slowly. Line C. Reference: Watanabe, N et al. Genes to Cells 2007. 12(5):603-609.
|
|
| KK204 |
C. elegans |
sma-4(e729) mab-5(e1239) unc-36(e251) III. Show Description
Small and Unc.
|
|
| PJ1227 |
C. elegans |
sma-4(e729) III; ccIs55 V. Show Description
ccIs55 [unc-54::lacZ + sup-7(st5)] V. Small body size. Slow growth. Strong lacZ staining in body wall.
|
|
| RG3229 |
C. elegans |
hum-4(ve729[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X. Show Description
Homozygous viable. Deletion of 12032 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TGCCCATTTTCAACAACTGACTTTAGTCGA ; Right flanking sequence: TTCCAGCTTCGGATTGATCTCTGTAATCAC. sgRNA #6: TAGTGCAGAACACCGAACGT; sgRNA #30: TAGCTCAAAATCTTCACGAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|