Search Strains

CRISPR/Cas9-engineered reporter allele. Reference: Vidal B, et al. bioRxiv 2021.11.30.470650; doi: https://doi.org/10.1101/2021.11.30.470650

CRISPR/Cas9-engineered reporter allele. Reference: Vidal B, et al. bioRxiv 2021.11.30.470650; doi: https://doi.org/10.1101/2021.11.30.470650

CRISPR/Cas9-engineered reporter allele. gpla-1 formerly known as flr-2. Reference: Vidal B, et al. bioRxiv 2021.11.30.470650; doi: https://doi.org/10.1101/2021.11.30.470650

CRISPR/Cas9-engineered reporter allele. Reference: Vidal B, et al. bioRxiv 2021.11.30.470650; doi: https://doi.org/10.1101/2021.11.30.470650

GFP tag inserted at the N-terminus of the endogenous cone-1 locus by CRISPR. Broad punctate expression of GFP. Allele generated by SUNY Biotech. [NOTE: Previously described as ceh-44(syb5437[gfp::ceh-44]) III. ceh-44 and cone-1 are located in the same locus and may share many exons, but are two separate genes with different functions and expression patterns. Please contact Oliver Hobert prior to publishing work using this strain.

Conditional knockout of dmsr-1 created via consecutive insertion of two FRT sites (GAAGTTCCTATTCTCTAGAAAGTATAGGAACTTC) flanking the second and third exons. The sequence within the two FRT sites is predicted to encode the first four transmembrane alpha helices. FLP recombination excises this sequence and introduces a frameshift, resulting in a likely molecular null allele of dmsr-1. Reference: Rossi L, et al. Curr Biol. 2025 Apr 20:S0960-9822(25)00355-0. doi: 10.1016/j.cub.2025.03.039. PMID: 40273913.

GFP tag inserted into endogenous fat-6 locus using Crispr/Cas9. fat-6::GFP expression in intestine and hypodermis. No obvious phenotype, but the fat-6 locus is likely inactive in this strain. Reference: Bodhicharla R, et al. Genetics. 2018 Sep;210(1):189-201.

CRISPR/Cas9-engineered 5421 bp deletion entirely removing both hlh-17 and hlh-31. Reference: Aguilar GR, et al. PLoS Biol. 2025 Jan 6;23(1):e3002979. doi: 10.1371/journal.pbio.3002979. PMID: 39761329

Deletion of the Nuclear Localization Sequence (NLS; 220-235aa) in the endogenously-tagged ifet-1 locus; mMaple tag inserted at the C-terminus. No embryonic viability defect in hermaphrodites. Reference: Bhatia P, et al. Life Sci Alliance. 2025 May 29;8(8):e202503387. doi: 10.26508/lsa.202503387. PMID: 40441896.

oyIs51 [srh-142::RFP]. ADF neurons are marked with RFP. sfGFP tag inserted at C-terminus of endogenous vap-1 locus. VAP-1::sfGFP can be used as a reporter for AMsh glia secretion. fig-1(syb6983) is an engineered deletion removing teh fig-1 coding sequence. fig-1 loss of function causes VAP-1::sfGFP accumulation and dye filling defects. Reference: Varandas KC, et al. Nat Commun. 2025 Jan 2;16(1):79. doi: 10.1038/s41467-024-55674-0. PMID: 39747235.

AID*::mScarlet tag inserted into endogenous dve-1 locus via CRISPR/Cas9 engineering. Reference: Alexander, K.D. et al. Nat Commun 2023 Nov 18;14(1):7520. PMID: 37980357.

FLP D5 recombinase expressed from the srx-9 locus. The srx-9::SL2::FLP driver caused recombination in RIS in most of the individuals, with no recombination detected outside of RIS. It is less penetrant but more specific than syb2346 syb6265[flp-11p::FLP D5::flp-11 3’UTR]. Reference: Rossi L, et al. Curr Biol. 2025 Apr 20:S0960-9822(25)00355-0. doi: 10.1016/j.cub.2025.03.039. PMID: 40273913.

sybIs62 [NISH-1::EGFP::3xFLAG + unc-119(+) + myo-2p::mCherry]. Transgene rescues nish-1(syb767) rilemenidine-induced longevity, rilemenidine-induced heat resistance, and rilemenidine-induced healthspan (body bends). Reference: Bennett DF, et al. Aging Cell. 2023 Feb;22(2):e13774. doi: 10.1111/acel.13774. PMID: 36670049.

ccIs55 [unc-54::lacZ + sup-7(st5)] V. Slow moving Kinkers. Slow growing.

ccIs55 [unc-54::lacZ + sup-7(st5)] V. Strain is viable at 15-25C. let-60(ga89) is temperature sensitive; however, with the gap-1 in the background the animals still appear somewhat Clr and Muv even at low temperatures.

ccIs55 [unc-54::lacZ + sup-7(st5)] V. Vul. Non-Clr at 25C. Poor growers (sub-viable?) at 25C.

ccIs55 [unc-54::lacZ + sup-7(st5)] V. No visible phenotype (may be smallish??). Dominant suppressor of daf-c phenotype of age-1.

ccIs55 [unc-54::lacZ + sup-7(st5)] V. Homozygous viable and fertile, but slow-growing, transparent, and small (but not scrawny). Coiler Unc. clr-1 is temperature-sensitive.

ccIs55 [unc-54::lacZ + sup-7(st5)] V. Egl: moderate to severe bloating. Clr-1 is ts. Homozygous viable and fertile, but slow-growing, transparent, and small (but not scrawny). Coiler Unc.

ccIs55 [unc-54::lacZ + sup-7(st5)] V. njEx38 [unc-54p::daf-2(+) + goa-1p::GFP + rol-6(su1006)]. Rollers. Pick Rollers to maintain. unc-43 gain-of-function suppressed; not markedly small. Egl-d. Lethal @ 25C; short L1's do not survive. No GFP expression.

ap426 is a CRISPR-engineered 8 bp deletion in the ALG-2 isoform A exon 2 causing a frameshift that produces a heavily truncated protein. Reference: Aalto AP, et al. PLoS Genet. 2018 Jun 21;14(6):e1007379.

Temperature sensitive. Unc-difficulty in crawling backwards. Behavior phenotype more pronounced at 25C than at 16C or 20C. Trichlorfon resistant. This strain replaced strain DH401 because Mike Nonet tested DH401 and found it didn't contain cha-1, but did have an unc-11 mutation (5/97).

Mild (leaky) allele of cha-1. Has approximately 10% WT ChAT activity. Behaviorally normal-normal growth and development. Males mate. Sensitive to cholinesterase inhibitor aldicarb.

Completely deficient in Class C acetylcholinesterase activity. Behavior is completely normal.

Defective in chemotaxis to all attractants and to D-tryptophan; partially defective in chemotaxis to CO2(phosphate) and H+(citrate). Thermotaxis weak. p673 previously called tax-3 or daf-21.

Male-female strain. Gonochoristic. Grows well on OP50. Freezes well with C. elegans protocol. Isolated by Robin Giblin-Davis in October 1990 in Dade County, FL in the abdomen of an adult female of Metamasius hemipterus. Consult Walter Sudhaus or Robin Giblin-Davis for appropriate taxonomy before publication. Do not distribute this strain; other labs should request it from the CGC. sp. 3 in Kiontke and Sudhaus Wormbook Ecology chapter.

Heterozygotes are Lon non-Unc. Df/Df is embryonic lethal. Maintain by picking single Lon non-Unc and check for dead embryos-->Lon non-Unc recombinants that have lost the Df arise frequently. Does not survive long periods of starvation-->survivors tend to be Lon non-Uncs without the Df. Do not distribute this strain; other labs should request it from the CGC.

Superficially wild-type but reduced brood size/early eggs laid/fewer viable eggs. CRISPR/Cas9 engineered STOP-IN null mutant of pam-1. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CTTTTCAGAATGGCGGCCTGTGGAAACCCAAGCG. right flanking sequence: CGGCGGTCAAATTTGAGAGGCTTCCAACATTCGCC. inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : CTGTGGAAACCCAAGCGCGG. Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616

Unc. Previously described as hC1 (hC1 also known as hIn1).

Panagrellus redivivus. Not hermaphroditic. Sexes separate. Growth Slow. Do not distribute this strain; other labs should request it from the CGC.

Viable allele of let-23. Vul. Throws males. Do not distribute this strain; other labs should request it from the CGC.

Suppresses sterility of lin-3(n1058) and let-23(sy10). Not involved in vulva development. Synthetic sterile in combination with lfe-2(sy326). Previously called lfe-1. Do not distribute this strain; other labs should request it from the CGC.

Suppresses sterility of lin-3(n1058) and let-23(sy10). Not involved in vulva development. Synthetic sterile in combination with lfe-2(sy326). Previously called lfe-1. Do not distribute this strain; other labs should request it from the CGC.

Suppresses sterility of lin-3(n1058) and let-23(sy10). Not involved in vulva development. Synthetic sterile in combination with lfe-2(sy326). Previously called lfe-1. Do not distribute this strain; other labs should request it from the CGC.

Suppresses sterility of lin-3(n1058) and let-23(sy10). Not involved in vulva development. Synthetic sterile in combination with lfe-2(sy326). Previously called lfe-1. Do not distribute this strain; other labs should request it from the CGC.

Suppresses sterility of lin-3(n1058) and let-23(sy10). Not involved in vulva development. Synthetic sterile in combination with lfe-2(sy326). Previously called lfe-1. Do not distribute this strain; other labs should request it from the CGC.

Pale, scrawny appearance, probably due to starvation. Hyperactive, backs frequently, egg laying constitutive, slow pharyngeal pumping. Probably null (based on sequence, S. Nurrish). Suppresses activated GOA-1 and partially suppresses egl-3(rf). Lethal in combination with eat-16(rf). Previously called sag-1. Do not distribute this strain; other labs should request it from the CGC.

syIs20 [gpa-1::lacZ + dpy-20(+)] V. Him. p-Vul. Abnormal secondary vulva lineage defect in 10% of animals. Reduced brood size as well as other pleiotropic defects. Males have ray defect (cannot mate) and SPD sheath to neuron transformation, which can be visualized by lacZ staining in syIs20 [gpa-1::lacZ] background: 1 cell per spicule stains in WT (the SPD neuron) whereas in hmg-1.2(sy549), 2 cells per spicule stain. sy549 previously called son-1. Do not distribute this strain; other labs should request it from the CGC.

syIs20 [gpa-1::lacZ + dpy-20(+)] V. Unc. Him. p-Vul. Abnormal secondary vulva lineage defect in 10% of animals. Reduced brood size as well as other pleiotropic defects. Males have ray defect (cannot mate) and SPD sheath to neuron transformation, which can be visualized by lacZ staining in syIs20 [gpa-1::lacZ] background: 1 cell per spicule stains in WT (the SPD neuron) whereas in hmg-1.2(sy549), 2 cells per spicule stain. sy549 previously called son-1. Do not distribute this strain; other labs should request it from the CGC.

Heterozgyotes are WT and segregate WT, DpyUncs and Vulvaless Unc-4s. sy97 is only 15% viable. Maintain by picking WT. Do not distribute this strain; other labs should request it from the CGC.

Heterozygotes are WT and segregate WT, DpyUnc and Sterile Unc-4s. sy10 is only 15% viable. Maintain by picking WT. Do not distribute this strain; other labs should request it from the CGC.

Hermaphrodites are WT. Males are defective in response and vulva location mating behaviors. Low mating efficiency with non-Unc hermaphrodites. Do not distribute this strain; other labs should request it from the CGC.

syIs20 [gpa-1::lacZ + dpy-20(+)] V. Dpy. Him. p-Vul. Abnormal secondary vulva lineage defect in 10% of animals. Reduced brood size as well as other pleiotropic defects. Males have ray defect (cannot mate) and SPD sheath to neuron transformation, which can be visualized by lacZ staining in syIs20 [gpa-1::lacZ] background: 1 cell per spicule stains in WT (the SPD neuron) whereas in hmg-1.2(sy549), 2 cells per spicule stain. sy549 previously called son-1. Do not distribute this strain; other labs should request it from the CGC.

syIs17 [pJMGoQLHS + (pMH86) dpy-20(+)] IV. Non-Dpy animals which at all stages progressively exhibit Go(gf) phenotype after heat shock treatment (standard treatment is 33C water bath for 30 minutes). Animals cease feeding, foraging, locomotion, ovulating and egg laying. Gravid adults eventually bag. "Suicides" are common. Do not distribute this strain; other labs should request it from the CGC.

Hermaphrodites are WT. Males are defective in response and vulva location mating behaviors. Low mating efficiency with non-Unc hermaphrodites. Do not distribute this strain; other labs should request it from the CGC.

Subtle ovulation defect which is viewable by Nomarski - 2 oocytes ovulate (pass into uterus) at the same time. Double mutants with lfe-2(sy326) and lfe-1(sy290) show sterility. Double mutant with lin-3(n1058) is fertile. Do not distribute this strain; other labs should request it from the CGC.

syEx429 [ipp-5p::GFP + rol-6(su1006)]. Maintain by picking Rollers. Construct pIP5 contains 2.0 kb promoter fragment upstream of ipp-1 driving GFP expression in distal spermatheca (in adults); pharynx and vulva (all stages). [NOTE: the syEx429 array in this strain was previously incorrectly annotated as carrying ipp-1p::GFP. The array contains an ipp-5p::GFP transgene.]

syEx470 [myo-3::unc-38::GFP]. Pick GFP+ to maintain. unc-38::GFP transgene produced by in vivo recombination between pR29 (myo-3p::unc-38) and pR26 (unc-38::GFP).

syEx475 [myo-3p::unc-68(see following comments) + myo-2p::GFP + pUC-19]. Pick GFP+ animals to maintain. myo-3p::unc-68 transgene was produced by injecting pEM23 (myo-3 promoter + unc-68 exons 1-8) + 18 kb unc-86 PCR fragment (start codon through nucleotide 18090) + pLM511 (unc-68 position 11989 to the end); fragments were recombined in vivo.

Homozygous sterile mutation balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP sterile en671 homozygotes. Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain.