Search Strains

ot1357 is CRISPR-engineered 5,741 bp deletion removing the entire aex-1 coding region, eliminating all spice isoforms. Sequence after edit: ACTTTTAACATTTTTAAAGCATTAGTTTTCCTTATGAATAGTCTATATTTTATCGACTGGCCGACATAAt. Reference: Sural S, et al. Sci Adv. 2025 Sep 26;11(39):eadw1270. doi: 10.1126/sciadv.adw1270. PMID: 40991693.

ot1360 is CRISPR-engineered 1,339 bp deletion removing the entire ins-1 coding region. Sequence after edit: TTATAGGGCATTTTTCAGTTCCTCACCGCTCTCAAATCAGGTCAATATCGTTGGCAGCTCACCGGACCCT. Reference: Sural S, et al. Sci Adv. 2025 Sep 26;11(39):eadw1270. doi: 10.1126/sciadv.adw1270. PMID: 40991693.

CRISPR/Cas9-engineered deletion removing entire hlh-13 locus. Reference: Aguilar GR, et al. PLoS Biol. 2025 Jan 6;23(1):e3002979. doi: 10.1371/journal.pbio.3002979. PMID: 39761329

CRISPR/Cas9-engineered deletion removing entire hlh-15 locus. Reference: Aguilar GR, et al. PLoS Biol. 2025 Jan 6;23(1):e3002979. doi: 10.1371/journal.pbio.3002979. PMID: 39761329

syb5437 is a GFP tag inserted at the N-terminus of the endogenous cone-1 locus by CRISPR. ot1409 is a deletion removing exons 1-7 from the endogenously-tagged cone-1 locus. Broad punctate expression of GFP. Please contact Oliver Hobert prior to publishing work using this strain.

syb5437 is a GFP tag inserted at the N-terminus of the endogenous cone-1 locus by CRISPR. ot1410 is a deletion removing exon 5 from the endogenously-tagged cone-1 locus. Broad punctate expression of GFP. Please contact Oliver Hobert prior to publishing work using this strain.

ot1427 is CRISPR-engineered 1,007 bp deletion removing the entire ins-7 coding region. Sequence after edit: CTTCGAAGGATAACCCCGAAGAAGCTGTTCCAAAACATAATGGTGGCTCTTCTGGATTTTGGGTTCAATT. Reference: Sural S, et al. Sci Adv. 2025 Sep 26;11(39):eadw1270. doi: 10.1126/sciadv.adw1270. PMID: 40991693.

CRISPR/Cas9-engineered 1691 bp deletion removing entire hlh-32 locus; similar to syb6773 deletion. Reference: Aguilar GR, et al. PLoS Biol. 2025 Jan 6;23(1):e3002979. doi: 10.1371/journal.pbio.3002979. PMID: 39761329

ot1015 is a GFP tag inserted at the C-terminus of the endogenous ceh-44 locus by CRISPR. ot1433 is a deletion removing exons 4-7 from the endogenously-tagged ceh-44 locus. No pan-neuronal nuclear GFP expression. Please contact Oliver Hobert prior to publishing work using this strain.

ot1015 is a GFP tag inserted at the C-terminus of the endogenous ceh-44 locus by CRISPR. ot1434 is a deletion removing exons 1-7 from the endogenously-tagged ceh-44 locus. No pan-neuronal nuclear GFP expression. Please contact Oliver Hobert prior to publishing work using this strain.

ot1443 is CRISPR-engineered 646 bp deletion of the ins-35 gene removing all the coding sequence except the last 7 aa, which should not be translated due to the absence of an ATG. Sequence after edit: ttctgaaatttttgaaattgtctaattttcCAGCAGACTCAGATGAACTATTCAATTAATAATTTAAGTT. Reference: Sural S, et al. Sci Adv. 2025 Sep 26;11(39):eadw1270. doi: 10.1126/sciadv.adw1270. PMID: 40991693.

ot1015 is a GFP tag inserted at the C-terminus of the endogenous ceh-44 locus by CRISPR. ot1447 is a deletion removing exon 5 of the endogenously-tagged ceh-44 locus. No pan-neuronal nuclear GFP expression. Please contact Oliver Hobert prior to publishing work using this strain.

Null allele. ot1466 is a CRISPR-engineered deletion removing the complete CDS. Normal growth & viability. Reference: Bayer E, et al. 2025. biorxiv: https://www.biorxiv.org/content/10.1101/2025.01.01.631014v2

SL2::mScarlet-I3::H2B tag inserted into endogenous pks-1 locus via CRISPR/Cas9 engineering. Reference: Cao WX, et al. (2024). bioRxiv: 2024.2006.2011.598534. https://doi.org/10.1101/2024.06.11.598534.

GFP::H2B tag inserted into endogenous pks-1 locus via CRISPR/Cas9 engineering. Reference: Cao WX, et al. (2024). bioRxiv: 2024.2006.2011.598534. https://doi.org/10.1101/2024.06.11.598534.

GFP tag inserted into endogenous golg-4 locus via CRISPR/Cas9 engineering. Reference: Cao WX, et al. Genetics. 2024 Oct 7;228(2):iyae126. doi: 10.1093/genetics/iyae126. PMID: 39103170.

mScarlet3 tag inserted into endogenous golg-4 locus via CRISPR/Cas9 engineering. Reference: Cao WX, et al. Genetics. 2024 Oct 7;228(2):iyae126. doi: 10.1093/genetics/iyae126. PMID: 39103170.

mScarlet-I3 tag inserted into endogenous golg-4 locus via CRISPR/Cas9 engineering. Reference: Cao WX, et al. Genetics. 2024 Oct 7;228(2):iyae126. doi: 10.1093/genetics/iyae126. PMID: 39103170.

CRISPR/Cas9 full deletion removing the entire coding-region of unc-42. Him and Unc. Reference: Fernandez RW, et al. Development. 2025 Aug 15;152(16):dev204958. doi: 10.1242/dev.204958. PMID: 40838983.

ot1015 is a GFP tag inserted at the C-terminus of the endogenous ceh-44 locus by CRISPR. ot1434 is a deletion removing exons 5-7 from the endogenously-tagged ceh-44 locus. No pan-neuronal nuclear GFP expression. Please contact Oliver Hobert prior to publishing work using this strain.

mScarlet-I3 tag inserted into endogenous unc-75 locus via CRISPR/Cas9 engineering. Reference: Cao WX, et al. (2024). bioRxiv: 2024.2006.2011.598534. https://doi.org/10.1101/2024.06.11.598534.

ot1545 is CRISPR-engineered 2,838 bp deletion removing the entire tph-1 coding region. Sequence after edit: tgtatattacgtgccgaattccagaagcaccacgcccaacacaaagacacgttttcctgcagaagaggaa. Reference: Sural S, et al. Sci Adv. 2025 Sep 26;11(39):eadw1270. doi: 10.1126/sciadv.adw1270. PMID: 40991693.

evIs82b [unc-129::GFP + dpy-20(+)] IV.

juIs76 [unc-25p::GFP + lin-15(+)] II. evIs82b [unc-129::GFP + dpy-20(+)] IV.

Heterozygotes are WT and GFP+ in the pharynx. ot59 is homozygous inviable. qIs48 is an insertion of ccEx9747 (carries myo-2::GFP, pes-10::GFP, and a gut enhancer fused to GFP) onto the hT2 chromosome and is homozygous lethal. otIs3[lin-15(+) + gcy-7::GFP]. otIs3 is expressed in ASEL in WT animals. In this ot59 strain, otIs3 is expressed in ASEL and ASER.

No visible phenotype. Normal chemotaxis to ammonium chloride.

otIs114 [lim-6p::GFP + rol-6(su1006)]. qIs48 [myo-2::GFP + pes-10::GFP + ges-1::GFP]. Homozygous hT2 animals are inviable. Heterozygotes are Rollers and GFP+. Homozygous lsy-22(ot244) otIs114 animals are Rollers and have a maternal effect embryonic lethal phenotype.

otIs3 [gcy-7::GFP + lin-15(+)]. qIs48 [myo-2::GFP + pes-10::GFP + ges-1::GFP]. Homozygous hT2 animals are inviable. Heterozygotes are WT and GFP+. Homozygous lsy-22(ot114) unc-101(m1) animals are Unc and have a maternal effect embryonic lethal phenotype. Whole genome sequenced strain.

otIs232 [che-1p::mCherry(C. elegans-optimized)::che-1 3'UTR + rol-6(su1006)]. Rollers. mCherry expression in ASER and ASEL. otEx4359 [die-1(prom8)::2NLS::YFP + elt-2::DsRed]. Pick animals with dsRed+ intestinal nuclei to maintain otEx4359. otEx4359 carries a minimal (1 kb) promoter driving 2NLS::YFP only in ASEL.

otIs313 [sem-2(fosmid)::YFP + rol-6(su1006)]. Rollers. Reference: Vidal B, et al. Development. 2015 Jul 15;142(14):2464-77.

Pick wild-type to maintain. Heterozygotes are wild-type and should segregate wild-type heterozygotes, bcl-11 homozygotes (L1 larval arrest with starved appearance), and Dpy Unc homozygotes (Medium Dpy, Shrinker, poor backing). Maintain by picking wild-type and scoring for proper segregation of progeny. bcl-11 homozygotes have weak pharyngeal muscle contractions and pharyngeal lumen fails to open. cu10 is a 555 bp deletion (V:6360921..6361460). Predicted bcl-11 null allele. Reference: Vilimas, Tomas. (2004). Genes regulating ceh-22 and pharyngeal development of Caenorhabditis elegans.. University of Illinois at Chicago. Thesis. https://hdl.handle.net/10027/12060

Homozygous viable.

Homozygous viable.

yokSi10 [trp-3p::GFP::H2B::trp-3 3'UTR + Cbr-unc-119(+)] II. GFP marker can be used for visualization of sperm. Reference: Takayama J & Onami S. Cell Rep. 2016 Apr 19;15(3):625-637.

ulbEx112 [gmap-1p::gmap-1(cDNA)::SL2::GFP + unc-122p::RFP]. Pick animals with RFP+ expression in coelomocytes to maintain. ulb13 is a CRISPR/Cas9 engineered 1515 bp deletion of gmap-1; flanking sequences ACCTATCCAAAGCTT and TGCCAAGACATTGAA. Expression of exogenous gmap-1 quantifiable via the GFP signal. Reference: Ngale Njume F, et al. iScience. 2022 Oct 14;25(11):105357. doi: 10.1016/j.isci.2022.105357. PMID: 36339267.

ulbEx78 [F16F9.3p::CFP]. Pick CFP+ to maintain. wrmScarlet expression in ciliated neurons provides a useful marker to track ciliary production of extracellular vesicles and their subsequent engulfment by the surrounding glial cells (AMsh, PHsh). Reference: Razzauti A & Laurent P. Elife. 2021 Sep 17:10:e67670. doi: 10.7554/eLife.67670. PMID: 34533135.

kyEx4787 [rig-3p::iGluSnFR + unc-122p::dsRed]. kyEx4786 [rig-3p:: RCaMP1e + unc-122p::GFP]. Pick animals with dsRed+ and GFP+ coelomocytes to maintain arrays. mgl-2(tm355) shows low rate of reversals. Strain carrying transgenes to monitor glutamate input and Ca activity in AVA. Reference: Katz M, et al. Nat Commun. 2019 Apr 23;10(1):1882.

kyEx4787 [rig-3p::iGluSnFR + unc-122p::dsRed]. kyEx4786 [rig-3p:: RCaMP1e + unc-122p::GFP]. Pick animals with dsRed+ and GFP+ coelomocytes to maintain arrays. mgl-2(tm355) mutation rescues the high reversal rate of glt-1(ok206). Strain carrying transgenes to monitor glutamate input and Ca activity in AVA. Reference: Katz M, et al. Nat Commun. 2019 Apr 23;10(1):1882.

Heterozygotes are WT and segregates WT, DpyUncs and Mua. rh197 animals are inviable as homozygotes.

Homozygous viable. Reference: Sin O, et al. Mol Cell. 2017 Mar 16;65(6):1096-1108.

dvIs62 [snb-1p::hTDP-43/3' long UTR + mtl-2p::GFP] X. Temperature-sensitive. Maintain at 16C to minimize selection against transgene. [NOTE: Out-crossing has eliminated embryonic lethality seen in parental strain CL6049 when raised at 25C.] Uncoordinated from hatching; phenotype is stronger at higher temperatures. Intestinal GFP expression. Parental strain CL6049 out-crossed 6x to N2. Reference: Koopman M, et al. MicroPubl Biol. 2023 Apr 19:2023:10.17912/micropub.biology.000766. doi: 10.17912/micropub.biology.000766. eCollection 2023. PMID: 37151213.

dvIs15 [unc-54(vector) + mtl-2::GFP]. Control strain for OW1601. Phenotype apparently Wild-type. Parental strain CL2122 out-crossed 6x to N2. Reference: Koopman M, et al. MicroPubl Biol. 2023 Apr 19:2023:10.17912/micropub.biology.000766. doi: 10.17912/micropub.biology.000766. eCollection 2023. PMID: 37151213.

Homozygous viable. Reference: van Ham TJ, et al. Cell. 2010 Aug 20;142(4):601-12.

C15H9.7. Homozygous viable. Reference: van der Goot AT, et al. Proc. Natl. Acad. Sci. U.S.A. 2012 109(37) 14912-7.

D2024.2. Homozygous viable. Reference: van der Goot AT, et al. Proc. Natl. Acad. Sci. U.S.A. 2012 109(37) 14912-7.

R07B7.5. Homozygous viable. Reference: van der Goot AT, et al. Proc. Natl. Acad. Sci. U.S.A. 2012 109(37) 14912-7.

K06A4.5. Homozygous viable. Reference: van der Goot AT, et al. Proc. Natl. Acad. Sci. U.S.A. 2012 109(37) 14912-7.

Male-female strain. From association with a terrestrial isopod, Trachelipus rathkii, that was collected from Taylorsville MetroPark, Dayton Ohio. Species ID confirmed by mating test with SB146.

Male-female strain. This is a 20X inbred (one gravid female per generation) derivative of LKC28, which is conspecific with CB5161. This is the strain that will be used for genome sequencing by Erich Schwarz/John Spieth. sp. 4 in Kiontke and Sudhaus Wormbook Ecology chapter.

Male-female strain. Inbred derivative of EM464. Inbred one gravid female per generation for 20 generations. Fitness high. Recommended for sequencing. [In Aug. 2005 the CGC received the 20 generation inbred line. Previous to this the CGC had been sending out a 14 generation inbred line, also called PB4641.] Strain used for sequencing.