| OH18501 |
C. elegans |
aex-1(ot1357) I. Show Description
ot1357 is CRISPR-engineered 5,741 bp deletion removing the entire aex-1 coding region, eliminating all spice isoforms. Sequence after edit: ACTTTTAACATTTTTAAAGCATTAGTTTTCCTTATGAATAGTCTATATTTTATCGACTGGCCGACATAAt. Reference: Sural S, et al. Sci Adv. 2025 Sep 26;11(39):eadw1270. doi: 10.1126/sciadv.adw1270. PMID: 40991693.
|
|
| OH18508 |
C. elegans |
daf-16(ot971[daf-16::GFP]) I; ins-1(ot1360) IV. Show Description
ot1360 is CRISPR-engineered 1,339 bp deletion removing the entire ins-1 coding region. Sequence after edit: TTATAGGGCATTTTTCAGTTCCTCACCGCTCTCAAATCAGGTCAATATCGTTGGCAGCTCACCGGACCCT. Reference: Sural S, et al. Sci Adv. 2025 Sep 26;11(39):eadw1270. doi: 10.1126/sciadv.adw1270. PMID: 40991693.
|
|
| OH18614 |
C. elegans |
hlh-13(ot1388) X. Show Description
CRISPR/Cas9-engineered deletion removing entire hlh-13 locus. Reference: Aguilar GR, et al. PLoS Biol. 2025 Jan 6;23(1):e3002979. doi: 10.1371/journal.pbio.3002979. PMID: 39761329
|
|
| OH18615 |
C. elegans |
hlh-15(ot1389) X. Show Description
CRISPR/Cas9-engineered deletion removing entire hlh-15 locus. Reference: Aguilar GR, et al. PLoS Biol. 2025 Jan 6;23(1):e3002979. doi: 10.1371/journal.pbio.3002979. PMID: 39761329
|
|
| OH18749 |
C. elegans |
cone-1(ot1409[*syb5437[GFP::con-1]) III. Show Description
syb5437 is a GFP tag inserted at the N-terminus of the endogenous cone-1 locus by CRISPR. ot1409 is a deletion removing exons 1-7 from the endogenously-tagged cone-1 locus. Broad punctate expression of GFP. Please contact Oliver Hobert prior to publishing work using this strain.
|
|
| OH18750 |
C. elegans |
cone-1(ot1410[*syb5437[GFP::con-1]) III. Show Description
syb5437 is a GFP tag inserted at the N-terminus of the endogenous cone-1 locus by CRISPR. ot1410 is a deletion removing exon 5 from the endogenously-tagged cone-1 locus. Broad punctate expression of GFP. Please contact Oliver Hobert prior to publishing work using this strain.
|
|
| OH18835 |
C. elegans |
ins-7(ot1427) IV. Show Description
ot1427 is CRISPR-engineered 1,007 bp deletion removing the entire ins-7 coding region. Sequence after edit: CTTCGAAGGATAACCCCGAAGAAGCTGTTCCAAAACATAATGGTGGCTCTTCTGGATTTTGGGTTCAATT. Reference: Sural S, et al. Sci Adv. 2025 Sep 26;11(39):eadw1270. doi: 10.1126/sciadv.adw1270. PMID: 40991693.
|
|
| OH18840 |
C. elegans |
hlh-32(ot1347) IV. Show Description
CRISPR/Cas9-engineered 1691 bp deletion removing entire hlh-32 locus; similar to syb6773 deletion. Reference: Aguilar GR, et al. PLoS Biol. 2025 Jan 6;23(1):e3002979. doi: 10.1371/journal.pbio.3002979. PMID: 39761329
|
|
| OH18871 |
C. elegans |
ceh-44(ot1433[*ot1015[ceh-44::gfp]]) III. Show Description
ot1015 is a GFP tag inserted at the C-terminus of the endogenous ceh-44 locus by CRISPR. ot1433 is a deletion removing exons 4-7 from the endogenously-tagged ceh-44 locus. No pan-neuronal nuclear GFP expression. Please contact Oliver Hobert prior to publishing work using this strain.
|
|
| OH18872 |
C. elegans |
ceh-44(ot1434[*ot1015[ceh-44::gfp]]) III. Show Description
ot1015 is a GFP tag inserted at the C-terminus of the endogenous ceh-44 locus by CRISPR. ot1434 is a deletion removing exons 1-7 from the endogenously-tagged ceh-44 locus. No pan-neuronal nuclear GFP expression. Please contact Oliver Hobert prior to publishing work using this strain.
|
|
| OH18895 |
C. elegans |
ins-35(ot1443) V. Show Description
ot1443 is CRISPR-engineered 646 bp deletion of the ins-35 gene removing all the coding sequence except the last 7 aa, which should not be translated due to the absence of an ATG. Sequence after edit: ttctgaaatttttgaaattgtctaattttcCAGCAGACTCAGATGAACTATTCAATTAATAATTTAAGTT. Reference: Sural S, et al. Sci Adv. 2025 Sep 26;11(39):eadw1270. doi: 10.1126/sciadv.adw1270. PMID: 40991693.
|
|
| OH18948 |
C. elegans |
ceh-44(ot1447[*ot1015[ceh-44::gfp]]) III. Show Description
ot1015 is a GFP tag inserted at the C-terminus of the endogenous ceh-44 locus by CRISPR. ot1447 is a deletion removing exon 5 of the endogenously-tagged ceh-44 locus. No pan-neuronal nuclear GFP expression. Please contact Oliver Hobert prior to publishing work using this strain.
|
|
| OH19034 |
C. elegans |
degt-1(ot1466) V. Show Description
Null allele. ot1466 is a CRISPR-engineered deletion removing the complete CDS. Normal growth & viability. Reference: Bayer E, et al. 2025. biorxiv: https://www.biorxiv.org/content/10.1101/2025.01.01.631014v2
|
|
| OH19124 |
C elegans |
pks-1(ot1488[pks-1::SL2::mScarlet-I3::H2B]) X. Show Description
SL2::mScarlet-I3::H2B tag inserted into endogenous pks-1 locus via CRISPR/Cas9 engineering. Reference: Cao WX, et al. (2024). bioRxiv: 2024.2006.2011.598534. https://doi.org/10.1101/2024.06.11.598534.
|
|
| OH19125 |
C elegans |
pks-1(ot1489[pks-1::SL2::GFP::H2B]) X. Show Description
GFP::H2B tag inserted into endogenous pks-1 locus via CRISPR/Cas9 engineering. Reference: Cao WX, et al. (2024). bioRxiv: 2024.2006.2011.598534. https://doi.org/10.1101/2024.06.11.598534.
|
|
| OH19204 |
C elegans |
golg-4(ot1508[GFP::golg-4]) III. Show Description
GFP tag inserted into endogenous golg-4 locus via CRISPR/Cas9 engineering. Reference: Cao WX, et al. Genetics. 2024 Oct 7;228(2):iyae126. doi: 10.1093/genetics/iyae126. PMID: 39103170.
|
|
| OH19205 |
C elegans |
golg-4(ot1509[mScarlet3::golg-4]) III. Show Description
mScarlet3 tag inserted into endogenous golg-4 locus via CRISPR/Cas9 engineering. Reference: Cao WX, et al. Genetics. 2024 Oct 7;228(2):iyae126. doi: 10.1093/genetics/iyae126. PMID: 39103170.
|
|
| OH19206 |
C elegans |
golg-4(ot1510[mScarlet-I3::golg-4]) III. Show Description
mScarlet-I3 tag inserted into endogenous golg-4 locus via CRISPR/Cas9 engineering. Reference: Cao WX, et al. Genetics. 2024 Oct 7;228(2):iyae126. doi: 10.1093/genetics/iyae126. PMID: 39103170.
|
|
| OH19210 |
C. elegans |
him-8(e1489) IV; unc-42(ot1187) V. Show Description
CRISPR/Cas9 full deletion removing the entire coding-region of unc-42. Him and Unc. Reference: Fernandez RW, et al. Development. 2025 Aug 15;152(16):dev204958. doi: 10.1242/dev.204958. PMID: 40838983.
|
|
| OH19219 |
C. elegans |
ceh-44(ot1515[*ot1015[ceh-44::gfp]]) III. Show Description
ot1015 is a GFP tag inserted at the C-terminus of the endogenous ceh-44 locus by CRISPR. ot1434 is a deletion removing exons 5-7 from the endogenously-tagged ceh-44 locus. No pan-neuronal nuclear GFP expression. Please contact Oliver Hobert prior to publishing work using this strain.
|
|
| OH19299 |
C elegans |
unc-75(ot1539[mScarlet-I3::unc-75]) I. Show Description
mScarlet-I3 tag inserted into endogenous unc-75 locus via CRISPR/Cas9 engineering. Reference: Cao WX, et al. (2024). bioRxiv: 2024.2006.2011.598534. https://doi.org/10.1101/2024.06.11.598534.
|
|
| OH19337 |
C. elegans |
tph-1(ot1545) II. Show Description
ot1545 is CRISPR-engineered 2,838 bp deletion removing the entire tph-1 coding region. Sequence after edit: tgtatattacgtgccgaattccagaagcaccacgcccaacacaaagacacgttttcctgcagaagaggaa. Reference: Sural S, et al. Sci Adv. 2025 Sep 26;11(39):eadw1270. doi: 10.1126/sciadv.adw1270. PMID: 40991693.
|
|
| OH4125 |
C. elegans |
evIs82b IV; wrk-1(ok695) X. Show Description
evIs82b [unc-129::GFP + dpy-20(+)] IV.
|
|
| OH4128 |
C. elegans |
juIs76 II; evIs82b IV. Show Description
juIs76 [unc-25p::GFP + lin-15(+)] II. evIs82b [unc-129::GFP + dpy-20(+)] IV.
|
|
| OH4605 |
C. elegans |
unc-37(ot59)/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III); him-8(e1489) IV; otIs3 V. Show Description
Heterozygotes are WT and GFP+ in the pharynx. ot59 is homozygous inviable. qIs48 is an insertion of ccEx9747 (carries myo-2::GFP, pes-10::GFP, and a gut enhancer fused to GFP) onto the hT2 chromosome and is homozygous lethal. otIs3[lin-15(+) + gcy-7::GFP]. otIs3 is expressed in ASEL in WT animals. In this ot59 strain, otIs3 is expressed in ASEL and ASER.
|
|
| OH4844 |
C. elegans |
gcy-5(tm897) II. Show Description
No visible phenotype. Normal chemotaxis to ammonium chloride.
|
|
| OH7115 |
C. elegans |
lsy-22(ot244) otIs114 I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
otIs114 [lim-6p::GFP + rol-6(su1006)]. qIs48 [myo-2::GFP + pes-10::GFP + ges-1::GFP]. Homozygous hT2 animals are inviable. Heterozygotes are Rollers and GFP+. Homozygous lsy-22(ot244) otIs114 animals are Rollers and have a maternal effect embryonic lethal phenotype.
|
|
| OH7116 |
C. elegans |
lsy-22(ot114) unc-101(m1) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III); otIs3 V. Show Description
otIs3 [gcy-7::GFP + lin-15(+)]. qIs48 [myo-2::GFP + pes-10::GFP + ges-1::GFP]. Homozygous hT2 animals are inviable. Heterozygotes are WT and GFP+. Homozygous lsy-22(ot114) unc-101(m1) animals are Unc and have a maternal effect embryonic lethal phenotype. Whole genome sequenced strain.
|
|
| OH9838 |
C. elegans |
otIs232; otEx4359. Show Description
otIs232 [che-1p::mCherry(C. elegans-optimized)::che-1 3'UTR + rol-6(su1006)]. Rollers. mCherry expression in ASER and ASEL. otEx4359 [die-1(prom8)::2NLS::YFP + elt-2::DsRed]. Pick animals with dsRed+ intestinal nuclei to maintain otEx4359. otEx4359 carries a minimal (1 kb) promoter driving 2NLS::YFP only in ASEL.
|
|
| OH9995 |
C. elegans |
otIs313. Show Description
otIs313 [sem-2(fosmid)::YFP + rol-6(su1006)]. Rollers. Reference: Vidal B, et al. Development. 2015 Jul 15;142(14):2464-77.
|
|
| OK461 |
C. elegans |
bcl-11(cu10)/unc-46(e177) dpy-11(e224) V. Show Description
Pick wild-type to maintain. Heterozygotes are wild-type and should segregate wild-type heterozygotes, bcl-11 homozygotes (L1 larval arrest with starved appearance), and Dpy Unc homozygotes (Medium Dpy, Shrinker, poor backing). Maintain by picking wild-type and scoring for proper segregation of progeny. bcl-11 homozygotes have weak pharyngeal muscle contractions and pharyngeal lumen fails to open. cu10 is a 555 bp deletion (V:6360921..6361460). Predicted bcl-11 null allele. Reference: Vilimas, Tomas. (2004). Genes regulating ceh-22 and pharyngeal development of Caenorhabditis elegans.. University of Illinois at Chicago. Thesis. https://hdl.handle.net/10027/12060
|
|
| OK559 |
C. elegans |
egrh-1(tm1736) X. Show Description
Homozygous viable.
|
|
| ON167 |
C. elegans |
pfn-3(tm1362) X. Show Description
Homozygous viable.
|
|
| ONA37 |
C.elegans |
yokSi10 II; unc-119(ed3) III. Show Description
yokSi10 [trp-3p::GFP::H2B::trp-3 3'UTR + Cbr-unc-119(+)] II. GFP marker can be used for visualization of sperm. Reference: Takayama J & Onami S. Cell Rep. 2016 Apr 19;15(3):625-637.
|
|
| OQ195 |
C. elegans |
gmap-1(ulb13) X; ulbEx112. Show Description
ulbEx112 [gmap-1p::gmap-1(cDNA)::SL2::GFP + unc-122p::RFP]. Pick animals with RFP+ expression in coelomocytes to maintain. ulb13 is a CRISPR/Cas9 engineered 1515 bp deletion of gmap-1; flanking sequences ACCTATCCAAAGCTT and TGCCAAGACATTGAA. Expression of exogenous gmap-1 quantifiable via the GFP signal. Reference: Ngale Njume F, et al. iScience. 2022 Oct 14;25(11):105357. doi: 10.1016/j.isci.2022.105357. PMID: 36339267.
|
|
| OQ366 |
C. elegans |
tsp-6(syb4122[tsp-6::wrmScarlet]) X; ulbEx78. Show Description
ulbEx78 [F16F9.3p::CFP]. Pick CFP+ to maintain. wrmScarlet expression in ciliated neurons provides a useful marker to track ciliary production of extracellular vesicles and their subsequent engulfment by the surrounding glial cells (AMsh, PHsh). Reference: Razzauti A & Laurent P. Elife. 2021 Sep 17:10:e67670. doi: 10.7554/eLife.67670. PMID: 34533135.
|
|
| OS11082 |
C. elegans |
mgl-2(tm355) I; kyEx4787; kyEx4786. Show Description
kyEx4787 [rig-3p::iGluSnFR + unc-122p::dsRed]. kyEx4786 [rig-3p:: RCaMP1e + unc-122p::GFP]. Pick animals with dsRed+ and GFP+ coelomocytes to maintain arrays. mgl-2(tm355) shows low rate of reversals. Strain carrying transgenes to monitor glutamate input and Ca activity in AVA. Reference: Katz M, et al. Nat Commun. 2019 Apr 23;10(1):1882.
|
|
| OS11091 |
C. elegans |
mgl-2(tm355) I; glt-1(ok206) X; kyEx4787; kyEx4786. Show Description
kyEx4787 [rig-3p::iGluSnFR + unc-122p::dsRed]. kyEx4786 [rig-3p:: RCaMP1e + unc-122p::GFP]. Pick animals with dsRed+ and GFP+ coelomocytes to maintain arrays. mgl-2(tm355) mutation rescues the high reversal rate of glt-1(ok206). Strain carrying transgenes to monitor glutamate input and Ca activity in AVA. Reference: Katz M, et al. Nat Commun. 2019 Apr 23;10(1):1882.
|
|
| OT125 |
C. elegans |
mua-9(rh197)/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
Heterozygotes are WT and segregates WT, DpyUncs and Mua. rh197 animals are inviable as homozygotes.
|
|
| OW1002 |
C elegans |
lir-3(tm813) II. Show Description
Homozygous viable. Reference: Sin O, et al. Mol Cell. 2017 Mar 16;65(6):1096-1108.
|
|
| OW1601 |
C. elegans |
dvIs62 X. Show Description
dvIs62 [snb-1p::hTDP-43/3' long UTR + mtl-2p::GFP] X. Temperature-sensitive. Maintain at 16C to minimize selection against transgene. [NOTE: Out-crossing has eliminated embryonic lethality seen in parental strain CL6049 when raised at 25C.] Uncoordinated from hatching; phenotype is stronger at higher temperatures. Intestinal GFP expression. Parental strain CL6049 out-crossed 6x to N2. Reference: Koopman M, et al. MicroPubl Biol. 2023 Apr 19:2023:10.17912/micropub.biology.000766. doi: 10.17912/micropub.biology.000766. eCollection 2023. PMID: 37151213.
|
|
| OW1603 |
C. elegans |
dvIs15. Show Description
dvIs15 [unc-54(vector) + mtl-2::GFP]. Control strain for OW1601. Phenotype apparently Wild-type. Parental strain CL2122 out-crossed 6x to N2. Reference: Koopman M, et al. MicroPubl Biol. 2023 Apr 19:2023:10.17912/micropub.biology.000766. doi: 10.17912/micropub.biology.000766. eCollection 2023. PMID: 37151213.
|
|
| OW452 |
C elegans |
moag-4(tm4909) I. Show Description
Homozygous viable. Reference: van Ham TJ, et al. Cell. 2010 Aug 20;142(4):601-12.
|
|
| OW454 |
C elegans |
kynu-1(tm4924) X. Show Description
C15H9.7. Homozygous viable. Reference: van der Goot AT, et al. Proc. Natl. Acad. Sci. U.S.A. 2012 109(37) 14912-7.
|
|
| OW477 |
C elegans |
afmd-1(tm4547) IV. Show Description
D2024.2. Homozygous viable. Reference: van der Goot AT, et al. Proc. Natl. Acad. Sci. U.S.A. 2012 109(37) 14912-7.
|
|
| OW478 |
C elegans |
kmo-1(tm4529) V. Show Description
R07B7.5. Homozygous viable. Reference: van der Goot AT, et al. Proc. Natl. Acad. Sci. U.S.A. 2012 109(37) 14912-7.
|
|
| OW479 |
C elegans |
haao-1(tm4627) V. Show Description
K06A4.5. Homozygous viable. Reference: van der Goot AT, et al. Proc. Natl. Acad. Sci. U.S.A. 2012 109(37) 14912-7.
|
|
| PB227 |
C. remanei |
Show Description
Male-female strain. From association with a terrestrial isopod, Trachelipus rathkii, that was collected from Taylorsville MetroPark, Dayton Ohio. Species ID confirmed by mating test with SB146.
|
|
| PB2801 |
C. brenneri |
Show Description
Male-female strain. This is a 20X inbred (one gravid female per generation) derivative of LKC28, which is conspecific with CB5161. This is the strain that will be used for genome sequencing by Erich Schwarz/John Spieth. sp. 4 in Kiontke and Sudhaus Wormbook Ecology chapter.
|
|
| PB4641 |
C. remanei |
Show Description
Male-female strain. Inbred derivative of EM464. Inbred one gravid female per generation for 20 generations. Fitness high. Recommended for sequencing. [In Aug. 2005 the CGC received the 20 generation inbred line. Previous to this the CGC had been sending out a 14 generation inbred line, also called PB4641.] Strain used for sequencing.
|
|