syIs17 [pJMGoQLHS + (pMH86) dpy-20(+)]. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

syIs17 [pJMGoQLHS + (pMH86) dpy-20(+)] IV. Non-Dpy animals which at all stages progressively exhibit Go(gf) phenotype after heat shock treatment (standard treatment is 33C water bath for 30 minutes). Animals cease feeding, foraging, locomotion, ovulating and egg laying. Gravid adults eventually bag. "Suicides" are common. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

syIs179 [N2 genomic DNA (45 ng/uL) + unc-119(+) (1 ng/uL) + lin-4p::YFP (PCR fusion) (1 ng/uL)(100:1)]. lin-4 promoter primers: GCGATATTTTGCTCGATTCC, ACAGGCCGGAAGCATAAACT. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.