Search Strains

syIs187 [pes-10::7XTCF-mCherry-let-858(3'UTR) + unc-119(+)]. Cherry POPTOP. POPTOP expression is best visualized using the mCherry/Texas Red filter. POPTOP transgenes display background expression. POPFOP(sy974) is the control plasmid with mutated binding sites. Analysis of POPFOP should always be used to subtract background expression. Do not distribute this strain; other labs should request it from the CGC.

syIs197 [hs::LIN-3c(cDNA) + myo-2p::DsRed + pha-1(+)]. Him. Maintain at 15C. To induce LIN-3/EGF expression, heat shock at 33C for 30min (water bath) and let animals recover at least 1hr from the behavioral effects of the heat shock. Heat shock-induced LIN-3 should inhibit feeding, locomotion and sensory responses for several hours. For details on EGF-induced quiescence, see Nature Neuroscience 10, 1300 - 1307 (2007). PS5970 is identical to PS5628 as described in Development 137, 2065-2074 (2010) except that it has been outcrossed to remove accumulating suppressors.

syEx1136 [myo-2p::GFP + unc-119(+)]. unc-119 animal rescued with array that expresses GFP in the pharyngeal muscles. Pick non-Unc animals to maintain the array. Highly outcrossed version of unc-119(ed3) generated by the Sternberg lab. Pick Unc animals for heavily outcrossed unc-119(ed3) to use for out-crossing biolistic insertions, mosSCI insertions or miniMos insertions based on unc-119 selection. Reference: Frokjær-Jensen C, et al. Nat Methods. 2012 Jan 30;9(2):117-8.

sy143 suppresses sy97 viability from 15% to 100%, P12 -> P11 transformations from 27% to 14% and Vul from 100% to 3%. Do not distribute this strain; other labs should request it from the CGC.

Dumpy. Viable allele of let-23. Vul. Do not distribute this strain; other labs should request it from the CGC.

Unc. Viable allele of let-23. Vul. Do not distribute this strain; other labs should request it from the CGC.

syIs528 [15xUAS::kin-2(G310D dominant negative)::let-858 3'UTR + ttx-3p::GFP + 1kb DNA ladder(NEB)] cGAL effector to lower PKA activity.

syIs583 [15xUAS::GCaMP7s::SL2::mKate::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder (NEB)] III. In vivo calcium indicator cGAL effector.

syIs587 [15xUAS::GCaMP7f::SL2::mKate::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder (NEB)]. In vivo calcium indicator cGAL effector.

syIs612 [15xUAS::GCaMP7b::SL2::mKate::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder (NEB)]. In vivo calcium indicator cGAL effector.

syIs824 [15xUAS::Chrimson::tdTomato::let-858 3'UTR + myo-2p::GFP + 1kb DNA ladder (NEB)]. Red light-activated channelrhodopsin cGAL effector. [NOTE: due to an error in the information submitted to the CGC, this strain was previously described as carrying the array syIs803 with a ttx-3::RFP co-injection marker. The correct name for the array is syIs824 and it carries the myo-2p::GFP marker.]

Homozygous sterile CRISPR null mutant balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP+, arrested hT2 aneuploids, and non-GFP sy2071 homozygotes (L2 or early arrested sterile). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP+ and check for correct segregation of progeny to maintain. CRISPR/Cas9 engineered STOP-IN null mutant of npp-10. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CAATCAAAACAAAGGATTGTTTGGTCAGCCAGCC. Right flanking sequence: AATAACAGTGGAACTACTGGCCTTTTCGGGGCGGC. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: GTAGTTCCACTGTTATTGGC. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.

Male leaving assay defective (Las), lethargic, hypereversal. Reference: Barrios, A, et al. Nat Neurosci. 2012 Dec;15(12):1675-82.

myIs4 [pkd-2p::pkd-2::GFP + unc-122p::GFP]. Phenotypically normal. sid-2::mScarlet is functional in environmental RNAi. Reference: Nikonorova IA, et al. Curr Biol. 2022 Mar 19;S0960-9822(22)00396-7. PMID: 35334227

Isolated at Devil's Lake State Park, Lincoln City, OR. Off a path about 200 feet from a dock in wet, organic topsoil in a forest.

fxSi1 [pie-1p::TIR-1::mRuby::unc-54 3' UTR + loxP, I: 2851003] I. Degron tag was inserted into the endogenous spe-44 locus in the JU2526 wild isolate background, allowing auxin-inducible spermatogenesis arrest and reversible male sterility. Reference: Kasimatis, KR et al. (2020) Post-Insemination Selection Dominates Pre-Insemination Selection in Driving Male Competitive Ability. bioRxiv doi: https://doi.org/10.1101/2021.06.23.449605

fxIs1 [pie-1p::TIR1::mRuby, I:2851009] I. Auxin-inducible spermatogenesis arrest, resulting in hermaphrodite self-sterility. AID* tag was inserted into the endogenous spe-44 locus. Reference: Kasimatis KR, et al. (2018) Auxin-Mediated Sterility Induction System for Longevity and Mating Studies in Caenorhabditis elegans. BioRvix. doi: https://doi.org/10.1101/284232.

fxIs1 [pie-1p::TIR1::mRuby, I:2851009] I. Auxin-inducible spermatogenesis arrest, resulting in hermaphrodite self-sterility and reversible male sterility. Him: males produced at ~30%. AID* tag was inserted into the endogenous spe-44 locus. Reference: Kasimatis KR, et al. (2018) Auxin-Mediated Sterility Induction System for Longevity and Mating Studies in Caenorhabditis elegans. BioRvix. doi: https://doi.org/10.1101/284232.

fxSi3 [hsp-16.41p::PEEL-1::tbb-2 3' UTR + rpl-28p::mKate2::unc-54 3'UTR + rps-0p::HygR::unc-54 3' UTR, I:2851003] I. fxSi4 [hsp-16.41p::PEEL-1::tbb-2 3'UTR + loxP, II: 8420157] II. Heat-shock strain can be maintained at 20C without any issues. Degron tag was inserted into the endogenous spe-44 locus, allowing auxin-inducible spermatogenesis arrest and reversible male sterility. Heat-shock-induced expression of PEEL-1 will cause lethality in both sexes. Five generations of lab adaptation following genome editing, all in the CB4856 background. Reference: Kasimatis, KR et al. (2021) Post-Insemination Selection Dominates Pre-Insemination Selection in Driving Male Competitive Ability. bioRxiv doi: https://doi.org/10.1101/2021.06.23.449605

fxSi1 [pie-1p::TIR-1::mRuby::unc-54 3' UTR + loxP, I: 2851003] I. fxSi4 [hsp-16.41p::PEEL-1::tbb-2 3'UTR + loxP, II: 8420157] II. fxSi6 [hsp-16.41p::PEEL-1::tbb-2 3' UTR + rpl-28p::mKate2::unc-54 3'UTR + rps-0p::HygR::unc-54 3' UTR, III: 10158855] III. Heat-shock strain can be maintained at 20C without any issues. Degron tag was inserted into the endogenous spe-44 locus, allowing auxin-inducible spermatogenesis arrest and reversible male sterility. Heat-shock-induced expression of PEEL-1 will cause lethality in both sexes. fxSi4 was originally inserted in a CB4845 background, but has been sufficiently backcrossed so that PX658 is >98.5% JU2526 genetic background. Reference: Kasimatis, KR. et al. (2021) Post-Insemination Selection Dominates Pre-Insemination Selection in Driving Male Competitive Ability. bioRxiv doi: https://doi.org/10.1101/2021.06.23.449605

fxIs10 [synthetic guide site::(delta)HygR::unc-54 3' UTR::LoxP, II:8420157]. fxIs10 is a CRISPR-engineered site for future transgene insertion via CRISPR utilizing a synthetic guide site (GGACAGTCCTGCCGAGGTGGAGG?) with a split hygromycin resistance selection marker; fxIs10 also introduced a small deletion of genomic sequence at the insertion site (II:8420158-8420207). Reference: Stevenson ZC, et al. G3 (Bethesda). 2020 Oct 5;10(10):3775-3782. doi: 10.1534/g3.120.401400. PMID: 32816924

fxSi8 [synthetic guide site1::3'(delta)HygR::unc-54 3' UTR::LoxN (I:2851003)]. fxSi8 is a CRISPR-engineered site in the N2 background for future transgene insertion via CRISPR utilizing a synthetic guide site (GTTTGAGTAGAGCACTCAGGAGG) with a split hygromycin resistance selection marker; fxSi8 also introduced a small deletion of genomic sequence at the insertion site (I:2851004-2851014).

fxSi9 [synthetic guide site1::3'(delta)HygR::unc-54 3' UTR::LoxN (I:2851003)]. fxSi9 is a CRISPR-engineered site in the MY16 background for future transgene insertion via CRISPR utilizing a synthetic guide site (GTTTGAGTAGAGCACTCAGGAGG) with a split hygromycin resistance selection marker; fxSi9 also introduced a small deletion of genomic sequence at the insertion site (I:2851004-2851014).

fxSi10 [synthetic guide site1::3'(delta)HygR::unc-54 3' UTR::LoxN (I:2851003)]. fxSi10 is a CRISPR-engineered site in the CB4856 background for future transgene insertion via CRISPR utilizing a synthetic guide site (GTTTGAGTAGAGCACTCAGGAGG) with a split hygromycin resistance selection marker; fxSi10 also introduced a small deletion of genomic sequence at the insertion site (I:2851004-2851014).

fxSi11 [synthetic guide site1::3'(delta)HygR::unc-54 3' UTR::LoxN (I:2851003)]. fxSi11 is a CRISPR-engineered site in the JU775 background for future transgene insertion via CRISPR utilizing a synthetic guide site (GTTTGAGTAGAGCACTCAGGAGG) with a split hygromycin resistance selection marker; fxSi11 also introduced a small deletion of genomic sequence at the insertion site (I:2851004-2851014).

fxSi13 [synthetic guide site1::3'(delta)HygR::unc-54 3' UTR::Lox2272 (III:10158855)]. fxSi13 is a CRISPR-engineered site in the N2 background for future transgene insertion via CRISPR utilizing a synthetic guide site (GTCCAGCGGCAGATCGGCGGAGG) with a split hygromycin resistance selection marker; fxSi13 also introduced a small deletion of genomic sequence at the insertion site (III:10158856-10158894).

oyIs96 [gcy-8p::FlincG3 gcy-8p::myr::TagRFP + unc-122p::dsRed]. Red fluorescence in coelomocytes and faint green fluorescence in AFD head neurons. cGMP fluorescent sensor (FlincG3) expression in AFD neurons allows visualization of AFD signaling. Generated in N2 background. Reference: Extrachromosomal array used in the generation of this strain detailed in https://doi.org/10.1534/genetics.119.302392.

Previously called sns-10(oy42).

kyIs104 [str-1::GFP]. AWB expression of GFP. mef-2 suppresses the phenotypes of kin-29 (small body size, hypersensitivity to dauer pheromone, reduced expression of the str-1 chemoreceptor in the AWB olfactory neurons). WT looking.

kyIs104 [str-1::GFP]. AWB expression of GFP. hda-4 suppresses the phenotypes of kin-29 (small body size, hypersensitivity to dauer pheromone, reduced expression of the str-1 chemoreceptor in the AWB olfactory neurons). WT looking.

kyIs104 [str-1::GFP]. AWB expression of GFP. mef-2 suppresses the phenotypes of kin-29 (small body size, hypersensitivity to dauer pheromone, reduced expression of the str-1 chemoreceptor in the AWB olfactory neurons). WT looking.

Previously called sns-10(oy56).

zcIs9 [hsp-60::GFP + lin-15(+)]. Constitutively activated mitochondrial UPR and an extended lifespan. [NOTE: This strains was previously described as only nduf-7(et19). It is in fact carrying the zcIs9 transgene.] Reference: Rauthan M, et al. G3 (Bethesda). 2015 Jun 1. pii: g3.115.018598.

Maintain at 20-25C. Cold-sensitive; inviable at 15C. Glucose-sensitive; will die on 20 mM glucose when grown on OP50. Characteristic withered tail tip defect. Reference: Svensk E, et al. PLoS Genet. 2016 Apr 15;12(4):e1005982.

Maintain at 20-25C. Cold-sensitive; inviable at 15C. Glucose-sensitve; will die on 20 mM glucose when grown on OP50. Characteristic withered tail tip defect. Reference: Svensk E, et al. PLoS Genet. 2016 Apr 15;12(4):e1005982.

Maintain at 20-25C. Cold-sensitive; inviable at 15C. Glucose-sensitve; will die on 20 mM glucose when grown on OP50. Characteristic withered tail tip defect. Reference: Svensk E, et al. PLoS Genet. 2016 Apr 15;12(4):e1005982.

Maintain at 20-25C. Cold-sensitive; inviable at 15C. Glucose-sensitive; will die on 20 mM glucose when grown on OP50. Characteristic withered tail tip defect. Reference: Svensk E, et al. PLoS Genet. 2016 Apr 15;12(4):e1005982.

Maintain at 20-25C. Cold-sensitive; inviable at 15C. Glucose-sensitve; will die on 20 mM glucose when grown on OP50. Characteristic withered tail tip defect. Reference: Svensk E, et al. PLoS Genet. 2016 Apr 15;12(4):e1005982.

No obvious phenotype. The fld-1 and mdt-15 mutations act as suppressors of paqr-2.

No obvious phenotype. The fld-1 and mdt-15 mutations act as suppressors of paqr-2.

The mdt-15(et14) gain-of-function mutation has no obvious phenotype on its own but can act as a paqr-2 suppressor. The C5832666T [WS200] mutation can be detected by PCR using the following primers: mdt-15(et14) Mut Fwd: 5’-GTGCCTCCAGATCCACAGCT-3’; mdt-15(et14) WT Fwd: 5’-GTGCCTCCAGATCCACAGCC-3’; mdt-15 Rev: 5’-CACCCATTGGAGCACCACT-3’. Annealing 65°C, expected product ~400 bp. Reference: Svensk E, et al. PLoS Genetics 9:e1003801. PMID: 24068966

The fld-1(et46) loss-of-function mutation has no obvious phenotype on its own but can act as a paqr-2 suppressor. fld-1(et46) carries a mutation in the splice acceptor site of intron 4, i.e. G>A. It can be detected using PCR with annealing at 65°C and using the following primers: et46_WT: atcccccaaaaaacccaatttttttgtag; et46_mut:atcccccaaaaaacccaatttttttgtaa; et46_rev: CCGGAATTGAGACCACctggaac. Expected product size: 389. Reference: Ruiz M, et al. eLife 7:e40686. PMID: 30509349

Isofemale line. Isolated by M. Rockman from a rotting palm fruit (?) on the Snyder-Molino trail on Barro Colorado Island, Panama (9°09.656' N, 79°50.490'W) on 4/24/12. Previously known as Caenorhabditis sp. 28.

Isofemale line. Isolated by M. Rockman from a rotten Gustavia superba flower on Barro Colorado Island, Panama (9°09.222'N, 79°49.564'W) on 4/25/12. Previously known as Caenorhabditis sp. 29.

RFP tag inserted at C-terminus of endogenous hum-1 via CRISPR/Cas9 editing.

dvIs19 [(pAF15) gst-4p::GFP::NLS] III. Hypomorphic allele of skn-1 that may be propagated as a homozygote. High rate of embryonic lethality and slightly lower brood size compared to N2. Reference: Tang L, Dodd W, Choe K. G3 (Bethesda). 2015 Dec 29.

Homozygous viable, non-Psa (Sawa), no gonadogenesis defects. Reference: Large EE and Mathies LD (2014 Jan 8). G3, doi: 10.1534/g3.113.009852.

Homozygous lethal deletion chromosome balanced by hT2. GFP+ heterozygotes are wild-type that segregate wild-type GFP+, arrested hT2 aneuploids, and non-GFP tm3309 homozygotes. tm3309 homozygotes are maternal effect lethal (late embryo & larval lethal) and have gonadogenesis defects. Previously known as swsn-2.1(tm3309). Pick wild-type GFP+ animals to maintain. Reference: Large EE and Mathies LD (2014 Jan 8). G3, doi: 10.1534/g3.113.009852.

rdEx1 [GFP::tra-1 + rol-6(su1006)]. Rollers. Array can cause sterility. Maintain by picking gravid Rollers. GFP::tra-1 fusion protein. Reference: Mathies LD, et al. Development. 2004 Sep;131(17):4333-43.

ZK970.6 Homozygous. Outer Left Sequence: CGGTGTCATTTCAGAGAGCA. Outer Right Sequence: GTTGAGGCAACCTTAAGCGA. Inner Left Sequence: TTGCTCAGCTTTTGGCCTAT. Inner Right Sequence: AGTGCGGATTGTCTGGAAAG. Inner Primer WT PCR Product: 3316. Deletion size: 1545 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807