| APL126 |
C. elegans |
ljfSi33 I; ljfSi10 II; egl-17(ljf14[egl-17p::mNG::3xFlag]) X. Show Description
ljfSi33 [myo3p::egl-17::mNG::SL2::2x mKate2::PH::3xHA::tbb-2 3'UTR loxN] I. ljfSi10 [hlh-8p::2x mTurquoise2::PH::tbb-2 3'UTR loxN] II. egl-17(ljf14) was generated by replacing the endogenous egl-17 coding sequence with mNG::3xFlag. Sex myoblast migration defects, Egl. EGL-17::mNG expression in body wall muscles. mTurquoise2::PH plasma membrane marker that is expressed in the M lineage. ljfSi33 is a single copy transgene inserted at Chr I:2851088, near ttTi4348. ljfSi10 was inserted at Chr II:8420157-8420243, near ttTi5605, using Cas9-triggered homologous recombination. Reference: Gibney TV & Pani AM. Development. 2025 Aug 21:dev.204802. doi: 10.1242/dev.204802. PMID: 40838367.
|
|
| APL130 |
C. elegans |
ljfSi10 II; egl-17(ljf25[egl-17::mNG::nlg-1 C-terminus]) X. Show Description
ljfSi10 [hlh-8p::2x mTurquoise2::PH::tbb-2 3'UTR loxN] II. Endogenously membrane tethered allele of EGL-17::mNG that is competent for contact-dependent signaling but does not diffuse extracellularly. egl-17(ljf25) was generated by inserting mNG and the transmembrane and C-terminal domains of NLG-1 at the C-terminus of egl-17. Sex myoblast migration defects, Egl. mTurquoise2::PH plasma membrane marker that is expressed in the M lineage. ljfSi10 was inserted at Chr II:8420157-8420243, near ttTi5605, using Cas9-triggered homologous recombination. Reference: Gibney TV & Pani AM. Development. 2025 Aug 21:dev.204802. doi: 10.1242/dev.204802. PMID: 40838367.
|
|
| APL199 |
C. elegans |
ljfSi10 II; egl-17(ljf24[egl-17::SL2::mNG::PH]) X. Show Description
ljfSi10 [hlh-8p::2x mTurquoise2::PH::tbb-2 3'UTR loxN] II. Endogenously engineered transcriptional reporter that can be used to visualize membranes of egl-17-expressing cells. egl-17(ljf24) was generated by inserting SL2::mNG::PH following the egl-17 stop codon. mTurquoise2::PH plasma membrane marker that is expressed in the M lineage. ljfSi10 was inserted at Chr II:8420157-8420243, near ttTi5605, using Cas9-triggered homologous recombination. Reference: Gibney TV & Pani AM. Development. 2025 Aug 21:dev.204802. doi: 10.1242/dev.204802. PMID: 40838367.
|
|
| APL23 |
C. elegans |
ljfSi10 II; egl-17(ljf7[egl-17::mNG::3xFlag]) X. Show Description
ljfSi10 [hlh-8p::2x mTurquoise2::PH::tbb-2 3'UTR loxN] II. mNeonGreen::3xFlag tag inserted at the C-terminus of the endogenous egl-17. mTurquoise2::PH plasma membrane marker that is expressed in the M lineage. ljfSi10 was inserted at Chr II:8420157-8420243, near ttTi5605, using Cas9-triggered homologous recombination. Reference: Gibney TV & Pani AM. Development. 2025 Aug 21:dev.204802. doi: 10.1242/dev.204802. PMID: 40838367.
|
|
| APL242 |
C. elegans |
ljfSi32 I; ljfSi10 II; egl-17(ljf14[egl-17p::mNG::3xFlag]) X. Show Description
ljfSi32 [egl-20 enhancer(-1261 610)::pes-10p::egl-17::mNG::SL2::2x mKate2::PH::3xHA::tbb-2 3'UTR loxN]) I. ljfSi10 [hlh-8p::2x mTurquoise2::PH::tbb-2 3'UTR loxN] II. Sex myoblast migration defects, Egl. EGL-17::mNG expression in a small number of posterior cells leads to posterior sex myoblast migration in hermaphrodites. egl-17(ljf14) was generated by replacing the endogenous egl-17 coding sequence with mNG::3xFlag. ljfSi32 is a single copy transgene inserted at Chr I:2851088, near ttTi4348. Reference: Gibney TV & Pani AM. Development. 2025 Aug 21:dev.204802. doi: 10.1242/dev.204802. PMID: 40838367.
|
|
| APL31 |
C. elegans |
lin-12(ljf31[lin-12::mNeonGreen[C1]::3xFLAG]) III. Show Description
mNG and 3xFLAG tags fused to the C-terminal end of the intracellular domain of the endogenous lin-12 locus using a 9 amino acid flexible linker. Reference: Pani AM, et al. A new toolkit to visualize and perturb endogenous LIN-12/Notch signaling in C. elegans. MicroPubl Biol. 2022 Jul 28;2022:10.17912/micropub.biology.000603. doi: 10.17912/micropub.biology.000603. PMID: 35966394.
|
|
| APL5 |
C. elegans |
ljfSi2 I. Show Description
ljfSi2 [hlh-8p::2x mKate2::D. melanogaster moesin actin-binding domain::SL2::2x mTurquoise2::PH::3xHA::tbb-2 3'UTR loxN] I. Single-copy transgenic strain that expressing mTurquoise2::PH plasma membrane marker and mKate2::moesin actin binding domain in the M lineage. lfjSi2 was inserted at Chr I:2851088, near ttTi4348, using Cas9-triggered homologous recombination. Reference: Gibney TV & Pani AM. Development. 2025 Aug 21:dev.204802. doi: 10.1242/dev.204802. PMID: 40838367.
|
|
| APL622 |
C. elegans |
ljfSi2 I; ljfSi39 IV; egl-17(ljf7[egl-17::mNG::3xFlag]) X. Show Description
ljfSi2 [hlh-8p::2x mKate2::D. melanogaster moesin actin-binding
domain::SL2::2x mTurquoise2::PH::3xHA::tbb-2 3'UTR loxN] I. ljfSi39 [myo-3p::egl-15(5a)::SL2::2x mKate2::PH::3xHA::tbb-2 3' UTR lox511i] IV. mNeonGreen::3xFlag tag inserted at the C-terminus of the endogenous egl-17. EGL-15(5a) expression in body wall muscle cells captures free EGL-17, reducing long-range signaling and causing moderately penetrant sex myoblast migration defects. ljfSi2 is a single copy transgene inserted at Chr I:2851088 near ttTi4348 using Cas9-triggered homologous recombination. ljfSi39 is a single copy transgene inserted at Chr IV:4237723 using Cas9-triggered homologous recombination. Reference: Gibney TV & Pani AM. Development. 2025 Aug 21:dev.204802. doi: 10.1242/dev.204802. PMID: 40838367.
|
|
| AQ3236 |
C. elegans |
ljSi2 II; unc-119(ed3) III. Show Description
ljSi2 [mec-7::GCaMP6m::SL2::TagRFP + unc-119(+)] II. GCaMP6m (13.693) and RFP expressed in touch receptor neurons (ALML/R, AVM, PVM, PLML/R). Dual expression of GCamp6m and RFP allows for ratio-metric corrections of motion artifacts. Reference: Cho Y, et al. Lab Chip. 2017 Jul 25;17(15):2609-2618.
|
|
| AQ351 |
C. elegans |
bus-8A(lj22) X. Show Description
Skiddy, bleach-sensitive, drug-sensitive, Bus, resistant to Leucobacter Verde2, hypersensitive to Leucobacter Verde1. lj22 is a missense mutation (R32C) in bus-8A and might also affect bus-8B (out-of-frame 5'exon U1). Reference: Partridge et al. (2008) PMID: 18395708.
|
|
| AQ866 |
C. elegans |
ser-4(ok512) III. Show Description
Y22D7AR.13. Hyperactive 5HT induced egglaying. Homozygous. Outer Left Sequence: AATTATCGGATTTAGGGCCG. Outer Right Sequence: ATGGAACGGAGCATTATTCG. Inner Left Sequence: CAACACGCAACGAATGTACC. Inner Right Sequence: TGTGAAGTTTGGGAGGCTTT. Inner primer WT PCR product: 3126. Outcrossed 5 times by Stanley Shyn. URL: http://www.celeganskoconsortium.omrf.org.
|
|
| AR1 |
C. elegans |
hcp-6(mr17) I. Show Description
15C: no phenotype. 26C: shifted as L4 or later results in 100% embryonic lethality; shifted before L4 results in Unc and Sterile animals. Intermediate phenotypes between 20-23C.
|
|
| AR2 |
C. elegans |
hcp-6(mr17) unc-73(e936) I. Show Description
Unc at all temperatures. For hcp-6: 15C: no phenotype. 26C: shifted as L4 or later results in 100% embryonic lethality; shifted before L4 results in Unc and Sterile animals. Intermediate phenotypes between 20-23C.
|
|
| ARK7 |
C. elegans |
spe-36(nwk1[spe-36::gfp]) IV; him-5(e1490) V. Show Description
GFP tag inserted into endogenous spe-36 (F40F11.4) locus. SPE-36::GFP expression in spermatids and spermatozoa. Reference: Krauchunas AR, et al. Curr Biol. 2023 Jul 24;33(14):3056-3064.e5. doi: 10.1016/j.cub.2023.06.051. PMID: 37453426.
|
|
| ARM101 |
C. elegans |
wamSi101 V; unc-119(ed3) III. Show Description
wamSi101 [eft-3p::mTFP::unc-54 3'UTR + Cbr-unc-119(+)] V. Expresses a single copy of mTFP from eft-3 promoter; construct utilizes the unc-54 terminator and 3'UTR. Can be used as a standard for multicolor imaging and quantitative microscopy. Reference: Sands B, et al. 2018. Translational Medicine of Aging Volume 2, January 2018, Pages 110.
|
|
| ARM103 |
C. elegans |
unc-119(ed3) III; wamSi103 V. Show Description
wamSi103 [eft-3p::mKO2::unc-54 3'UTR + Cbr-unc-119(+)] V. Expresses a single copy of mKO2 from eft-3 promoter; construct utilizes the unc-54 terminator and 3'UTR. Can be used as a standard for multicolor imaging and quantitative microscopy. Reference: Sands B, et al. 2018. Translational Medicine of Aging Volume 2, January 2018, Pages 110.
|
|
| ARM112 |
C. elegans |
wamSi112 II; unc-119(ed3) III Show Description
wamSi112 [eft-3p::mScarlet::unc-54 3'UTR + Cbr-unc-119(+)] II. Expresses a single copy of mScarlet from eft-3 promoter; construct utilizes the unc-54 terminator and 3'UTR. Can be used as a standard for multicolor imaging and quantitative microscopy. Reference: Sands B, et al. 2018. Translational Medicine of Aging Volume 2, January 2018, Pages 110.
|
|
| ARM118 |
C. elegans |
wamSi118 II; unc-119(ed3) III. Show Description
wamSi118 [eft-3p::mCerulean3::unc-54 3'UTR + Cbr-unc-119(+)] II. Expresses a single copy of mCerulean3 from eft-3 promoter; construct utilizes the unc-54 terminator and 3'UTR. Can be used as a standard for multicolor imaging and quantitative microscopy. Reference: Sands B, et al. 2018. Translational Medicine of Aging Volume 2, January 2018, Pages 110.
|
|
| ARM123 |
C. elegans |
unc-119(ed3) III; wamSi123 V. Show Description
wamSi123 [eft-3p::mECitrine::unc-54 3'UTR + Cbr-unc-119 (+)] V. Expresses a single copy of mECitrine from eft-3 promoter; construct utilizes the unc-54 terminator and 3'UTR. Can be used as a standard for multicolor imaging and quantitative microscopy. Reference: Sands B, et al. 2018. Translational Medicine of Aging Volume 2, January 2018, Pages 110.
|
|
| ARM3 |
C. elegans |
wamSi3 II; unc-119(ed3) III. Show Description
wamSi3 [eft-3p::mNeptune::unc-54 3'UTR + Cbr-unc-119(+)] II. Expresses a single copy of mNeptune from eft-3 promoter; construct utilizes the unc-54 terminator and 3'UTR. Can be used as a standard for multicolor imaging and quantitative microscopy. Reference: Sands B, et al. 2018. Translational Medicine of Aging Volume 2, January 2018, Pages 110.
|
|
| ARM6 |
C. elegans |
wamSi6 II; unc-119(ed3) III. Show Description
wamSi6 [eft-3p::mTagBFP2::unc-54 3'UTR + Cbr-unc-119(+)] II. Expresses a single copy of mTagBFP2 from eft-3 promoter; construct utilizes the unc-54 terminator and 3'UTR. Can be used as a standard for multicolor imaging and quantitative microscopy. Reference: Sands B, et al. 2018. Translational Medicine of Aging Volume 2, January 2018, Pages 110.
|
|
| ARM7 |
C. elegans |
wamSi7 II; unc-119(ed3) III. Show Description
wamSi7 [eft-3p::mTagRFP-T::unc-54 3'UTR + Cbr-unc-119(+)] II. Expresses a single copy of mTagRFP-T from eft-3 promoter; construct utilizes the unc-54 terminator and 3'UTR. Can be used as a standard for multicolor imaging and quantitative microscopy. Reference: Sands B, et al. 2018. Translational Medicine of Aging Volume 2, January 2018, Pages 110.
|
|
| AT18 |
C elegans |
srf-6(yj13) II. Show Description
No visible phenotype. Whole genome sequenced strain. Reference: Grenache DG, et al. Proc Natl Acad Sci U S A. 1996 Oct 29;93(22):12388-93.
|
|
| AT24 |
C. elegans |
srf-6(yj15) II. Show Description
No visible phenotype. Whole genome sequenced strain.
|
|
| AT25 |
C elegans |
srf-6(yj41) II. Show Description
No visible phenotype. Whole genome sequenced strain.
|
|
| AT28 |
C. elegans |
kyIs140 I; srf-6(yj13) unc-4(e120) II. Show Description
kyIs140 [str-2::GFP + lin-15(+)] I. Kinker; can't back up. srf-6 mutants express str-2::GFP in both AWC neurons (2AWC ON phenotype; wild-type phenotype is 1AWC ON): check for this phenotype to avoid reversion of srf-6(yj13). srf-6 mutants were originally identified by binding of an L1-specific antibody in later larval stages (L1-L4).
|
|
| AT30 |
C. elegans |
kyIs140 I; nsy-1(ok593) unc-4(e120) II. Show Description
kyIs140 [str-2::GFP + lin-15(+)] I. nsy-1(ky593) has no visible phenotype, but can be tracked by linked Unc-4 phenotype (Kinker, can't back up). str-2::GFP is expressed in both AWC neurons.
|
|
| ATD1 |
C. elegans |
unc-119(ed3) III; sqt-3(sc8) par-1(b274) V/nT1[unc-?(n754) let-?] (IV;V); zuIs45 V. Show Description
zuIs45 [nmy-2p::nmy-2::GFP + unc-119(+)] V. Balanced heterozygotes are Unc and segregate Unc (heterozygotes), Rol Par (sqt-3 par-1 homozygotes; maternal effect lethal), and dead eggs (nT1 homozygotes). NMY-2::GFP is expressed in the germline and somatic gonad. Cross of JJ1473 and KK288. Unknown if unc-119(ed3) is still present or homozygous in background. Reference: Small LE & Dawes AT. Mol Biol Cell. 2017 Aug 1;28(16):2220-2231.
|
|
| ATD2 |
C. elegans |
par-2(or373) unc-119(ed3) III; zuIs45 V. Show Description
zuIs45 [nmy-2p::nmy-2::GFP + unc-119(+)] V. Temperature-sensitive maternal-effect lethal. Maintain at 15C. NMY-2::GFP is expressed in the germline and somatic gonad. Cross of JJ1473 and EU822. Unknown if unc-119(ed3) is still present or homozygous in background. NOTE: this strain was originally described as heterozygous for lin-2(e1309), but lin-2 has been lost; this strain is now homozygous wild-type for lin-2. Reference: Small LE & Dawes AT. Mol Biol Cell. 2017 Aug 1;28(16):2220-2231.
|
|
| ATD3 |
C. elegans |
lon-1(e185) par-3(e2074) unc-119(ed3) III; zuIs45 V; sDp3(III;f) Show Description
zuIs45 [nmy-2p::nmy-2::GFP + unc-119(+)] V. Pick wild-type to maintain. Worms carrying the sDp3 duplication are wild-type; animals that have lost the duplication are Lon Par (maternal effect lethal). Cross of JJ1473 and KK237. Unknown if unc-119(ed3) is still present or homozygous in background. Reference: Small LE & Dawes AT. Mol Biol Cell. 2017 Aug 1;28(16):2220-2231.
|
|
| ATD6 |
C. elegans |
par-6(zu222) unc-101(m1)/hIn1[unc-54(h1040)] I; unc-119(ed3) III; zuIs45 V. Show Description
zuIs45 [nmy-2p::nmy-2::GFP + unc-119(+)] V. Balanced worms are wild-type and segregate wild-type (heterozygotes), Coil Par (par-6 unc-101 homozygotes; maternal effect lethal), and paralyzed Unc (hIn1 homozygotes). Par phenotype is slightly leaky, but survivors are agametic. NMY-2::GFP is expressed in the germline and somatic gonad. Cross of JJ1473 and KK818. Unknown if unc-119(ed3) is still present or homozygous in background. Reference: Small LE & Dawes AT. Mol Biol Cell. 2017 Aug 1;28(16):2220-2231.
|
|
| ATD7 |
C. elegans |
par-2(ok1723)/sC1[dpy-1(s2170)], unc-119(ed3?) III; zuIs45 V. Show Description
zuIs45 [nmy-2p::nmy-2::GFP + unc-119(+)] V. Heterozygous worms are wild type and segregate wild type, Par (maternal effect lethal), and Dpy (sC1 homozygotes). Heterozygous and Par adults are indistinguishable on the plate. Maintain by picking wild-type worms and checking for correct segregation of progeny. NMY-2::GFP is expressed in the germline and somatic gonad. Cross of JJ1473 and VC1313. Unknown if unc-119(ed3) is still present or homozygous in background. Reference: Small LE & Dawes AT. Mol Biol Cell. 2017 Aug 1;28(16):2220-2231.
|
|
| ATU2301 |
C. elegans |
aceIs1; goeIs3. Show Description
goeIs3 [myo-3p::SL1::GCamP3.35::SL2::unc-54 3'UTR + unc-119(+)]. aceIs1 [myo-3p::mitochondrial LAR-GECO + myo-2p::RFP]; likely inserted into LG II. Reporter expresses the calcium indicator cytosolic GCaMP3 and mitochondrial LAR-GECO in all body wall muscles.
|
|
| AU133 |
C. elegans |
agIs17 IV. Show Description
agIs17 [myo-2p::mCherry + irg-1p::GFP] IV. GFP in pharynx and intestine that turns on upon infection with pathogenic Pseudomonas aeruginosa strain PA14. Reference: Dunbar TL, et al. Cell Host Microbe. 2012 Apr 19;11(4):375-86.
|
|
| AU147 |
C. elegans |
daf-16(mgDf47) I; glp-1(e2141) III. Show Description
Temperature sensitive sterility. Maintain at 15C.
|
|
| AU166 |
C. elegans |
daf-16(mgDf47) I; fog-2(q71) V. Show Description
Temperature sensitive. Maintain by mating males & females at 15C. fog-2(q71) is male-female.
|
|
| AU37 |
C. elegans |
glp-4(bn2) I; sek-1(km4) X. Show Description
Temperature sensitive sterility. Maintain at 15C. Enhanced sensitivity to pathogens.
|
|
| AU78 |
C. elegans |
agIs219 III. Show Description
agIs219 [T24B8.5p::GFP::unc-54 3' UTR + ttx-3p::GFP::unc-54 3' UTR] III. References: Shivers RP, et al. PLoS Genet. 2010 Apr 1;6(4):e1000892. Shivers RP, et al. Cell Host Microbe. 2009 Oct 22;6(4):321-30.
|
|
| AUM1054 |
C. elegans |
gsk-3(tm2223) I/hT2[bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Homozygous sterile mutation balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP sterile tm2223 homozygotes. Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Reference: Furuta T, et al. Development. 2018 May 14;145(10). pii: dev161042. doi: 10.1242/dev.161042.
|
|
| AUM1535 |
C. elegans |
drsh-1(viz43)/tmC18[dpy-5(tmIs1200[myo-2p::mVenus])] I. Show Description
[D943G] substitution mutation in conserved residue within RNAse III domain. Balancer marked with myo-2p::Venus. Pick fertile wild-type (non-Dpy) Venus+ to maintain. drsh-1(viz43) homozygous animals display heterochronic phenotypes beginning at L3/L4 molt and typically burst at the vulva in L4. Heterozygotes are wild-type with pharyngeal Venus fluorescence, and segregate Venus+ heterozygotes, non-Venus viz-43 homozygotes, and Dpy Venus+ tmC18 homozygotes. Reference: Barish S, et al. Human Mol Genet. 2022 Aug 25;31(17):2934-2950. doi: 10.1093/hmg/ddac085. PMID: 35405010.
|
|
| AUM1811 |
C. elegans |
plk-3(viz156[plk-3::GGSGGGSGGGSG::GFP]) IV. Show Description
GFP tag with linker sequence inserted at C-terminus of endogenous plk-3 locus. Expressed primarily in both male and hermaphrodite gonad. Reference: Ortega J, et al. Sci. Adv.10,eadp0466(2024).DOI:10.1126/sciadv.adp0466 https://www.science.org/doi/10.1126/sciadv.adp0466 PMID: 39356768.
|
|
| AUM1830 |
C. elegans |
sart-3(tm6688)/tmC9 [F36H1.2(tmIs1221)] IV. Show Description
Homozygous sterile deletion balanced by tmC9 [F36H1.2(tmIs1221[myo-2p::Venus])]. Heterozygotes are wild-type Venus+ in pharynx, and segregate wild-type Venus+ heterozygotes, non-Venus Sterile (tm6688 homozygotes), and Venus+ Mec Unc (tmC9 homozygotes). Pick viable fertile Venus+ animals and check for correct segregation of progeny to maintain. Reference: Furuta T & Arur S. 2023. sart-3 functions to regulate germline sex determination in C. elegans. microPublication Biology. PubMed ID: 37206989.
|
|
| AUM1863 |
C. elegans |
sart-3(tm15993)/tmC9 [F36H1.2(tmIs1221)] IV. Show Description
Homozygous lethal deletion balanced by tmC9 [F36H1.2(tmIs1221[myo-2p::Venus])]. Heterozygotes are wild-type Venus+ in pharynx, and segregate wild-type Venus+ heterozygotes, non-Venus Sterile (tm15993 homozygotes), and Venus+ Mec Unc (tmC9 homozygotes). Pick viable fertile Venus+ animals and check for correct segregation of progeny to maintain. 93% of tm15993 homozygotes die before adulthood and those that escape are sterile. Reference: Furuta T & Arur S. 2023. sart-3 functions to regulate germline sex determination in C. elegans. microPublication Biology. PubMed ID: 37206989.
|
|
| AUM1870 |
C. elegans |
ZK813.1(viz166[fln-1p::ZK813.1]) X. Show Description
The endogenous promoter of ZK813.1 (1046 bp) was replaced with the fln-1 promoter (947 bp) to limit the expression of ZK813.1 to the spermatheca and allow analysis of RNA transfer from soma to oocytes. Reference: Trimmer KA, et al. Cell Rep. 2023 May 23;42(6):112544.
doi: 10.1016/j.celrep.2023.112544. PMID: 37227820.
.
|
|
| AUM1880 |
C. elegans |
prg-1(viz142[V5::mCherry::GSIGSLRSI::prg-1]) I; plk-3(viz172[plk-3 delta 21u-10935] viz156[plk-3::GGSGGGSGGGSG::GFP]) IV. Show Description
viz172 is a series of point mutations at that piRNA binding site in endogenously-tagged plk-3 locus. GFP tag with linker sequence inserted at C-terminus of endogenous plk-3 locus. V5 epitope and mCherry tags with a flexible linker inserted after the first 18 nt of the coding sequence of endogenous prg-1 locus. Both tagged transgenes are primarily expressed and localized in both hermaphrodite and male gonad. Eight silent mutations in 21u-10935 binding site. Original plk-3: CTCAGTCGTATCGAATATGCCCAA viz172: CTgtccCGTATCGAgTAcGCaCAg Reference: Ortega J, et al. Sci. Adv.10,eadp0466(2024).DOI:10.1126/sciadv.adp0466 https://www.science.org/doi/10.1126/sciadv.adp0466 PMID: 39356768.
|
|
| AUM2023 |
C. elegans |
daf-2(e1370) unc-119(ed3) III; vizIs23. Show Description
vizIs23 [pie-1p::GFP::daf-2(WT)::pie-1 3'UTR + unc-119(+)]. Maintain at 15C; pick superficially wild-type animals to avoid silencing of the transgene. pie-1 driven DAF-2 coding region with GFP transgene rescues the germline defects of daf-2(e1370). Slow growing. The transgene is sometimes silenced in the germline resulting in dauerunc animals at 25C. Reference: Lopez AL 3rd, et al. Dev Cell. 2013 Oct 28;27(2):227-40.
|
|
| AUM2059 |
C. elegans |
vizSi20 II; unc-119(ed3) III. Show Description
vizSi20 [mex-5p::GFP::gsk-3 (K65A,E77A,D161A,D180A)::tbb-2 3UTR + unc-119(+)] II. Superficially wild-type. vizSi20 was inserted into Chr II ttTi5605 using MosSci. GSK-3 cDNA was rendered kinase dead by replacing K65, E77, D161 and D180 to alanine. The transgene does not rescue gsk-3 sterility or embryonic lethality defects. Reference: Furuta T, et al. Development. 2018 May 14;145(10). pii: dev161042. doi: 10.1242/dev.161042.
|
|
| AUM2071 |
C. elegans |
vizSi32 II; unc-119(ed3) III. Show Description
vizSi32 [cdk-2p(intron)::GFP::tbb-2 3 UTR + unc-119(+)] II. vizSi32 was inserted into ttTi5605 on Chr II using MosSci. Intron 1 of cdk-2 drives drives GFP expression in this transgene. Reference: Furuta T, et al. Development. 2018 May 14;145(10). pii: dev161042. doi: 10.1242/dev.161042.
|
|
| AUM2073 |
C. elegans |
vizSi34 II; unc-119(ed3) III. Show Description
vizSi34 [cdk-2p::GFP::tbb-2 3 UTR + unc-119(+)] II. Superficially wild-type. vizSi34 was inserted into ttTi5605 on Chr II using MosSci. Predicted cdk-2 promoter (from WormBase) drives GFP expression. Reference: Furuta T, et al. Development. 2018 May 14;145(10). pii: dev161042. doi: 10.1242/dev.161042.
|
|
| AV106 |
C. elegans |
spo-11(ok79) IV/nT1 [unc-?(n754) let-?] (IV;V). Show Description
Heterozygotes are Unc and segregate Uncs (heterozygotes), non-Unc spo-11 homozygotes, and dead eggs (nT1 homozygotes). spo-11 homozygotes produce an average of ~200 fertilized eggs but only about 0.1 progeny survive to adulthood. When mated to N2 males, spo-11 homozygotes will produce at least 5-10 cross progeny.
|
|