| AMP100 |
C. elegans |
ieSi57 II; rpb-2(cer135[rpb-2::GFP(delta)piRNA::AID*::3xFLAG]) III. Show Description
ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. cer135 is a rpb-2::GFP(delta)piRNA::AID*::3xFLAG tag inserted into the endogenous rpb-2 locus. This strain allows auxin-dependent disruption of RNA polymerase II with dose-dependent lifespan shortening. Reference: Oswal N, et al. PLoS Comput Biol. 2022 Sep 30;18(9):e1010415. PMID: 36178967.
|
|
| ANA65 |
C. elegans |
adeIs1 II; unc-119(ed3) III. Show Description
adeIs1 [mex-5::spd-1::GFP + unc-119(+)] II. The transgene has been inserted on chromosome II, using the MosSCI technique. This strains expresses the SPD-1 protein fused to GFP in the germline (both males and females) and in embryos. SPD-1 is nucleolar in interphase and labels the central spindle in mitosis and meiosis, later accumulating at the midbody. Reference: Nahaboo W, et al. Mol Biol Cell. 2015 Jun 1;26(11):2020-9. doi: 10.1091/mbc.E14-12-1577.
|
|
| ANA72 |
C. elegans |
adeIs1 II; unc-119(ed3) III; ltIs37 IV. Show Description
adeIs1 [mex-5::spd-1::GFP + unc-119(+)] II. ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. Superficially wild-type. SPD-1::GFP and mCherry-tagged histones allow visualisation of chromatin with central spindle/midbody during cell divisions. Reference: Nahaboo W, et al. Mol Biol Cell. 2015 Jun 1;26(11):2020-9.
|
|
| AP36 |
C. elegans |
mep-1(ok421) IV/nT1 [qIs51] (IV;V). Show Description
qIs51 [myo-2p::GFP + pes-10p::GFP + F22B7.9p::GFP]. Heterozygotes are wild-type GFP+ and segregate non-GFP ok421 homozygotes, wild-type GFP+ heterozygotes, and arrested nT1[qIs51] aneuploids. Pick wild-type GFP+ and check for correct segregation of progeny to maintain. Received new stock 12/02.
|
|
| ARK7 |
C. elegans |
spe-36(nwk1[spe-36::gfp]) IV; him-5(e1490) V. Show Description
GFP tag inserted into endogenous spe-36 (F40F11.4) locus. SPE-36::GFP expression in spermatids and spermatozoa. Reference: Krauchunas AR, et al. Curr Biol. 2023 Jul 24;33(14):3056-3064.e5. doi: 10.1016/j.cub.2023.06.051. PMID: 37453426.
|
|
| AT28 |
C. elegans |
kyIs140 I; srf-6(yj13) unc-4(e120) II. Show Description
kyIs140 [str-2::GFP + lin-15(+)] I. Kinker; can't back up. srf-6 mutants express str-2::GFP in both AWC neurons (2AWC ON phenotype; wild-type phenotype is 1AWC ON): check for this phenotype to avoid reversion of srf-6(yj13). srf-6 mutants were originally identified by binding of an L1-specific antibody in later larval stages (L1-L4).
|
|
| AT30 |
C. elegans |
kyIs140 I; nsy-1(ok593) unc-4(e120) II. Show Description
kyIs140 [str-2::GFP + lin-15(+)] I. nsy-1(ky593) has no visible phenotype, but can be tracked by linked Unc-4 phenotype (Kinker, can't back up). str-2::GFP is expressed in both AWC neurons.
|
|
| ATD1 |
C. elegans |
unc-119(ed3) III; sqt-3(sc8) par-1(b274) V/nT1[unc-?(n754) let-?] (IV;V); zuIs45 V. Show Description
zuIs45 [nmy-2p::nmy-2::GFP + unc-119(+)] V. Balanced heterozygotes are Unc and segregate Unc (heterozygotes), Rol Par (sqt-3 par-1 homozygotes; maternal effect lethal), and dead eggs (nT1 homozygotes). NMY-2::GFP is expressed in the germline and somatic gonad. Cross of JJ1473 and KK288. Unknown if unc-119(ed3) is still present or homozygous in background. Reference: Small LE & Dawes AT. Mol Biol Cell. 2017 Aug 1;28(16):2220-2231.
|
|
| ATD2 |
C. elegans |
par-2(or373) unc-119(ed3) III; zuIs45 V. Show Description
zuIs45 [nmy-2p::nmy-2::GFP + unc-119(+)] V. Temperature-sensitive maternal-effect lethal. Maintain at 15C. NMY-2::GFP is expressed in the germline and somatic gonad. Cross of JJ1473 and EU822. Unknown if unc-119(ed3) is still present or homozygous in background. NOTE: this strain was originally described as heterozygous for lin-2(e1309), but lin-2 has been lost; this strain is now homozygous wild-type for lin-2. Reference: Small LE & Dawes AT. Mol Biol Cell. 2017 Aug 1;28(16):2220-2231.
|
|
| ATD3 |
C. elegans |
lon-1(e185) par-3(e2074) unc-119(ed3) III; zuIs45 V; sDp3(III;f) Show Description
zuIs45 [nmy-2p::nmy-2::GFP + unc-119(+)] V. Pick wild-type to maintain. Worms carrying the sDp3 duplication are wild-type; animals that have lost the duplication are Lon Par (maternal effect lethal). Cross of JJ1473 and KK237. Unknown if unc-119(ed3) is still present or homozygous in background. Reference: Small LE & Dawes AT. Mol Biol Cell. 2017 Aug 1;28(16):2220-2231.
|
|
| ATD6 |
C. elegans |
par-6(zu222) unc-101(m1)/hIn1[unc-54(h1040)] I; unc-119(ed3) III; zuIs45 V. Show Description
zuIs45 [nmy-2p::nmy-2::GFP + unc-119(+)] V. Balanced worms are wild-type and segregate wild-type (heterozygotes), Coil Par (par-6 unc-101 homozygotes; maternal effect lethal), and paralyzed Unc (hIn1 homozygotes). Par phenotype is slightly leaky, but survivors are agametic. NMY-2::GFP is expressed in the germline and somatic gonad. Cross of JJ1473 and KK818. Unknown if unc-119(ed3) is still present or homozygous in background. Reference: Small LE & Dawes AT. Mol Biol Cell. 2017 Aug 1;28(16):2220-2231.
|
|
| ATD7 |
C. elegans |
par-2(ok1723)/sC1[dpy-1(s2170)], unc-119(ed3?) III; zuIs45 V. Show Description
zuIs45 [nmy-2p::nmy-2::GFP + unc-119(+)] V. Heterozygous worms are wild type and segregate wild type, Par (maternal effect lethal), and Dpy (sC1 homozygotes). Heterozygous and Par adults are indistinguishable on the plate. Maintain by picking wild-type worms and checking for correct segregation of progeny. NMY-2::GFP is expressed in the germline and somatic gonad. Cross of JJ1473 and VC1313. Unknown if unc-119(ed3) is still present or homozygous in background. Reference: Small LE & Dawes AT. Mol Biol Cell. 2017 Aug 1;28(16):2220-2231.
|
|
| ATU3301 |
C. elegans |
ccIs4251 I; aceIs1. Show Description
ccIs4251 [myo-3p::GFP::LacZ::NLS + myo-3p::mitochondrial GFP + dpy-20(+)] I. aceIs1 [myo-3p::mitochondrial LAR-GECO + myo-2p::RFP]; likely inserted into LG II. Reporter expresses the calcium indicator mitochondrial LAR-GECO in all body wall muscles.
|
|
| AU133 |
C. elegans |
agIs17 IV. Show Description
agIs17 [myo-2p::mCherry + irg-1p::GFP] IV. GFP in pharynx and intestine that turns on upon infection with pathogenic Pseudomonas aeruginosa strain PA14. Reference: Dunbar TL, et al. Cell Host Microbe. 2012 Apr 19;11(4):375-86.
|
|
| AU78 |
C. elegans |
agIs219 III. Show Description
agIs219 [T24B8.5p::GFP::unc-54 3' UTR + ttx-3p::GFP::unc-54 3' UTR] III. References: Shivers RP, et al. PLoS Genet. 2010 Apr 1;6(4):e1000892. Shivers RP, et al. Cell Host Microbe. 2009 Oct 22;6(4):321-30.
|
|
| AUM1054 |
C. elegans |
gsk-3(tm2223) I/hT2[bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Homozygous sterile mutation balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP sterile tm2223 homozygotes. Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Reference: Furuta T, et al. Development. 2018 May 14;145(10). pii: dev161042. doi: 10.1242/dev.161042.
|
|
| AUM1787 |
C. elegans |
cosa-1(viz154[GFP::cosa-1]) III. Show Description
GFP tag inserted at N-terminus of endogenous cosa-1 locus. Expressed primarily in both hermaphrodite and male gonad. Reference: Ortega J, et al. Sci. Adv.10,eadp0466(2024).DOI:10.1126/sciadv.adp0466 https://www.science.org/doi/10.1126/sciadv.adp0466 PMID: 39356768.
|
|
| AUM1811 |
C. elegans |
plk-3(viz156[plk-3::GGSGGGSGGGSG::GFP]) IV. Show Description
GFP tag with linker sequence inserted at C-terminus of endogenous plk-3 locus. Expressed primarily in both male and hermaphrodite gonad. Reference: Ortega J, et al. Sci. Adv.10,eadp0466(2024).DOI:10.1126/sciadv.adp0466 https://www.science.org/doi/10.1126/sciadv.adp0466 PMID: 39356768.
|
|
| AUM1880 |
C. elegans |
prg-1(viz142[V5::mCherry::GSIGSLRSI::prg-1]) I; plk-3(viz172[plk-3 delta 21u-10935] viz156[plk-3::GGSGGGSGGGSG::GFP]) IV. Show Description
viz172 is a series of point mutations at that piRNA binding site in endogenously-tagged plk-3 locus. GFP tag with linker sequence inserted at C-terminus of endogenous plk-3 locus. V5 epitope and mCherry tags with a flexible linker inserted after the first 18 nt of the coding sequence of endogneous prg-1 locus. Both tagged transgenes are primarily expressed and localized in both hermaphrodite and male gonad. Eight silent mutations in 21u-10935 binding site. Original plk-3: CTCAGTCGTATCGAATATGCCCAA viz172: CTgtccCGTATCGAgTAcGCaCAg Reference: Ortega J, et al. Sci. Adv.10,eadp0466(2024).DOI:10.1126/sciadv.adp0466 https://www.science.org/doi/10.1126/sciadv.adp0466 PMID: 39356768.
|
|
| AUM2023 |
C. elegans |
daf-2(e1370) unc-119(ed3) III; vizIs23. Show Description
vizIs23 [pie-1p::GFP::daf-2(WT)::pie-1 3'UTR + unc-119(+)]. Maintain at 15C; pick superficially wild-type animals to avoid silencing of the transgene. pie-1 driven DAF-2 coding region with GFP transgene rescues the germline defects of daf-2(e1370). Slow growing. The transgene is sometimes silenced in the germline resulting in dauerunc animals at 25C. Reference: Lopez AL 3rd, et al. Dev Cell. 2013 Oct 28;27(2):227-40.
|
|
| AUM2059 |
C. elegans |
vizSi20 II; unc-119(ed3) III. Show Description
vizSi20 [mex-5p::GFP::gsk-3 (K65A,E77A,D161A,D180A)::tbb-2 3UTR + unc-119(+)] II. Superficially wild-type. vizSi20 was inserted into Chr II ttTi5605 using MosSci. GSK-3 cDNA was rendered kinase dead by replacing K65, E77, D161 and D180 to alanine. The transgene does not rescue gsk-3 sterility or embryonic lethality defects. Reference: Furuta T, et al. Development. 2018 May 14;145(10). pii: dev161042. doi: 10.1242/dev.161042.
|
|
| AUM2071 |
C. elegans |
vizSi32 II; unc-119(ed3) III. Show Description
vizSi32 [cdk-2p(intron)::GFP::tbb-2 3 UTR + unc-119(+)] II. vizSi32 was inserted into ttTi5605 on Chr II using MosSci. Intron 1 of cdk-2 drives drives GFP expression in this transgene. Reference: Furuta T, et al. Development. 2018 May 14;145(10). pii: dev161042. doi: 10.1242/dev.161042.
|
|
| AUM2073 |
C. elegans |
vizSi34 II; unc-119(ed3) III. Show Description
vizSi34 [cdk-2p::GFP::tbb-2 3 UTR + unc-119(+)] II. Superficially wild-type. vizSi34 was inserted into ttTi5605 on Chr II using MosSci. Predicted cdk-2 promoter (from WormBase) drives GFP expression. Reference: Furuta T, et al. Development. 2018 May 14;145(10). pii: dev161042. doi: 10.1242/dev.161042.
|
|
| AV157 |
C. elegans |
spo-11(me44)/nT1 [unc-?(n754) let-? qIs50] (IV;V). Show Description
Balanced heterozygotes are GFP+ Unc and segregate GFP+ Unc (heterozygotes), non-GFP non-Unc spo-11(me44) homozygotes, and dead eggs (nT1 homozygotes). spo-11(me44) homozygotes are viable and produce more than 90% dead eggs (a large fraction of the survivors are males strong Him phenotype); cytologically they lack chiasmata in diakinesis-stage oocytes and lack RAD-51 foci. Maintain by picking Unc.
|
|
| AV221 |
C. elegans |
unc-119(ed3) meT8 (III); meIs4 meT8 (IV); meIs1. Show Description
meIs1 [pie-1p::GFP::lacI + unc-119(+)]. meIs4 [lac-O + rol-6(su1006) + lacO] IV. Pick Rol worms to maintain. This strain throws both Rol and non-Rol worms, seemingly due to random silencing of rol-6(su1006) in the lacO array, meIs4. The strain expresses GFP::LacI in the gonad and embryos that is observed as foci (of lacO target) and nuclear haze. The expression level of GFP::LacI occasionally becomes low possibly due to random silencing of meIs1. If this happens, heat shock the strain at 25°C for 3 days, and pick a clone that exhibits bright GFP signals. Even at the highest expression level, GFP signal is too weak to detect with a fluorescent dissection microscope, and it is necessary to use a regular compound fluorescent microscope with an oil immersion 60X or 100X objective. The NA of the objective should be higher than 1.4. Reference: Bilgir C, et al. G3 (Bethesda). 2013 Mar 11. pii: g3.112.005165v1.
|
|
| AV267 |
C. elegans |
syp-3(me42)/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Heterozygotes are WT and GFP+. Segregate syp-3(me42) homozygotes that are non-GFP and lay mostly dead eggs; these mutants form abnormal synaptonemal complex formation during meiosis. Homozygous hT2[bli-4 let-? qIs48] animals are inviable.
|
|
| AV271 |
C. elegans |
him-3(me80)/nT1 [unc-?(n754) let-? qIs50] (IV;V). Show Description
Balanced heterozygotes are GFP+ Unc and segregate GFP+ Unc (heterozygotes), non-GFP non-Unc him-3(me80) homozygotes, and dead eggs (nT1 homozygotes). him-3(me80) homozygotes are viable and non-Unc. They produce more than 85% dead eggs and a large fraction (11%) of the survivors are males (Him phenotype). Cytologically they exhibit a reduced level of HIM-3 loading and fewer stretches of SYP-1 than WT. In diakinesis-stage oocytes, they contain a mixture of bivalents and univalents. Maintain by picking Unc.
|
|
| AV280 |
C. elegans |
unc-119(e2498) III; him-17(ok424) V; meIs5. Show Description
meIs5 [him-17::GFP + unc-119(+)]. him-17::GFP is expressed in the germline. meIs5 not mapped.
|
|
| AV307 |
C. elegans |
syp-1(me17) V/nT1 [unc-?(n754) let-? qIs50] (IV;V). Show Description
Balanced heterozygotes are GFP+ Unc and segregate GFP+ Unc (heterozygotes), non-GFP non-Unc syp-1(me17) homozygotes, and dead eggs (nT1 homozygotes). syp-1(me17) homozygotes produce 95% dead embryos and 38% males. Cytologically they lack chiasmata in diakinesis-stage oocytes, exhibit persistent polarized nuclear organization during earlier meiotic prophase, lack synaptonemal complexes, and exhibit unstable pairing of homologous chromosomes. qIs50 is an insertion of ccEx9747 with markers: myo-2::GFP expressed brightly in the pharynx throughout development, pes-10::GFP expressed in embryos, and a gut promoter (F22B7.9) driving GFP in the intestine.
|
|
| AV473 |
C. elegans |
rad-50(ok197) V/nT1 [qIs51] (IV;V). Show Description
qIs51 [myo-2p::GFP + pes-10p::GFP + F22B7.9p::GFP]. Heterozygotes are wild-type GFP+ and segregate non-GFP ok197 homozygotes (viable, sterile), wild-type GFP+ heterozygotes, and arrested nT1[qIs51] aneuploids. rad-50 homozygotes are viable, produce more than 95% dead eggs and a large fraction of the survivors are male (Him phenotype). Pick wild-type GFP+ and check for correct segregation of progeny to maintain. Reference: Hayashi M, et al. PLoS Genet. 2007 Nov;3(11):e191.
|
|
| AV554 |
C. elegans |
dpy-13(e184) unc-5(ox171) IV/nT1 [qIs51] (IV;V); krIs14 V/nT1 [qIs51] (IV;V). Show Description
krIs14 [hsp-16.48p::MosTransposase + lin-15B + unc-122p::GFP]. Heterozygotes are WT with GFP (GFP+ coelomocytes & GFP+ pharynx), and segregate WT GFP, arrested nT1[qIs51] aneuploids, and Dpy Unc homozygotes (GFP+ pharynx & GFP+ coelomocytes). Homozygous nT1[qIs51] inviable. Pick WT with GFP (GFP+ pharynx & GFP+ coelomocytes) and check for correct segregation of progeny to maintain. References: Robert V & Bessereau JL. EMBO J. 2007 Jan 10;26(1):170-83. doi: 10.1038/sj.emboj.7601463. PMID: 17159906. Rosu S, et al. Science. 2011 Dec 2;334(6060):1286-9. doi: 10.1126/science.1212424. PMID: 22144627. Toraason E, et al. Elife. 2024 Aug 8;13:e80687. doi: 10.7554/eLife.80687. PMID: 39115289.
|
|
| AV630 |
C. elegans |
meIs8 II. Show Description
meIs8 [pie-1p::GFP::cosa-1 + unc-119(+)] II. Transgene contains a combination of cDNA and genomic sequences of cosa-1 including 212 bp of 3'UTR. GFP is expressed in the adult germline as 6 bright foci per nucleus (one per chromosome pair) from late pachytene through diplotene stages. Reference: Yokoo R, et al. Cell. 2012 Mar 30;149(1):75-87.
|
|
| AV828 |
C. elegans |
nbs-1(me102) meIs8/mIn1 [mIs14 dpy-10(e128)] II. Show Description
meIs8 [pie-1p::GFP::cosa-1 + unc-119(+)] II. Transgene contains a combination of cDNA and genomic sequences of cosa-1 including 212 bp of 3'UTR. GFP is expressed in the adult germline as 6 bright foci per nucleus (one per chromosome pair) from late pachytene through diplotene stages. Homozygous sterile mutation balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP me103 homozygotes (sterile adult). Pick WT dim GFP and check for correct segregation of progeny to maintain. nbs-1(me103) homozygotes have frayed and aggregated chromosomes at diakinesis of meiosis I. References: Girard C, et al. Proc Natl Acad Sci U S A. 2018 May 8;115(19):E4443-E4452. Yokoo R, et al. Cell. 2012 Mar 30;149(1):75-87.
|
|
| AV860 |
C. elegans |
nbs-1(me103)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
Homozygous sterile mutation balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP me103 homozygotes (sterile adult). Pick WT dim GFP and check for correct segregation of progeny to maintain. nbs-1(me103) homozygotes have frayed and aggregated chromosomes at diakinesis of meiosis I. Reference: Girard C, et al. Proc Natl Acad Sci U S A. 2018 May 8;115(19):E4443-E4452.
|
|
| AVS310 |
C. elegans |
artEx27. Show Description
artEx27 [hpk-1p::hpk-1::GFP + rol-6(su1006)]. Full-length C-terminal hpk-1::GFP fusion. Broad pattern of developmental GFP expression in the intestine, hypodermal seam cells, and neurons. Reference: Das R, et al. PLoS Genet. 2017 Oct 16;13(10):e1007038. doi: 10.1371/journal.pgen.1007038. PMID: 29036198; PMCID: PMC5658188.
|
|
| AVS394 |
C. elegans |
artEx12. Show Description
artEx12 [hpk-1p::GFP + rol-6(su1006)]. Pick Rollers to maintain. Transcriptional fusion of hpk-1 promoter with GFP. Reference: Das R, et al. PLoS Genet. 2017 Oct 16;13(10):e1007038. doi: 10.1371/journal.pgen.1007038. PMID: 29036198; PMCID: PMC5658188.
|
|
| AVS397 |
C elegans |
gpIs1; artEx35. Show Description
gpIs1 [hsp-16.2p::GFP]. artEx35 [sur-5p::hpk-1::CFP + myo-2p::mCherry)]. Pick animals with red pharynx to maintain. Inducible GFP fluorescence after >1 hour heat shock. Reference: Das R, PLoS Genet. 2017 Oct 16;13(10):e1007038. doi: 10.1371/journal.pgen.1007038. PMID: 29036198; PMCID: PMC5658188.
|
|
| AVS411 |
C elegans |
artEx30. Show Description
artEx30 [hpk-1p::hpk-1::tdTomato + hsf-1p::hsf-1::GFP + rol-6 (su1006)]. Pick Rollers to maintain. Reference: Das R, PLoS Genet. 2017 Oct 16;13(10):e1007038. doi: 10.1371/journal.pgen.1007038. PMID: 29036198; PMCID: PMC5658188.
|
|
| AVS413 |
C. elegans |
hpk-1(pk1393) X; artEx29. Show Description
artEx29 [hpk-1p::hpk-1::GFP + rol-6(su1006)]. Full-length C-terminal hpk-1::GFP fusion transgene rescues the progeric phenotype of hpk-1(pk1393). Reference: Das R, et al. PLoS Genet. 2017 Oct 16;13(10):e1007038. doi: 10.1371/journal.pgen.1007038. PMID: 29036198; PMCID: PMC5658188.
|
|
| AWR41 |
C. elegans |
lin-35(kea7[lin-35p::degron::GFP::lin-35]) I. Show Description
N-terminal degron::GFP tag was inserted into the endogenous lin-35 locus. Generated in N2 background. Reference: Willis AR, et al. Sci Adv. 2021 May 5;7(19):eabf3114. PMID: 33952520 [NOTE: lin-35(kea7) is an N-terminal tag; the methods section of the paper incorrectly describes the tag as a C-terminal insertion.]
|
|
| AWR45 |
C. elegans |
pals-22(kea8[pals-22::GFP::degron]) III. Show Description
C-terminal GFP::degron tag was inserted into the endogenous pals-22 locus. Generated in N2 background. Reference: Willis AR, et al. Sci Adv. 2021 May 5;7(19):eabf3114. PMID: 33952520 [NOTE: pals22(kea8) is a C-terminal tag; the methods section of the paper incorrectly describes the tag as an N-terminal insertion.]
|
|
| AWR54 |
C. elegans |
lin-35(kea7[lin-35p::AID*::GFP::lin-35]) I; ieSi57 II. Show Description
ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. N-terminal AID*::GFP tag was inserted into the endogenous lin-35 locus. A single copy insertion of eft-3p::TIR1::mRuby allows auxin-inducible degradation of LIN-35 in somatic tissues. Generated in N2 background. Reference: Willis AR, et al. Sci Adv. 2021 May 5;7(19):eabf3114. PMID: 33952520 [NOTE: lin-35(kea7) is an N-terminal tag; the methods section of the paper incorrectly describes the tag as a C-terminal insertion.]
|
|
| AWR56 |
C. elegans |
lin-35(kea7[lin-35p::AID*::GFP::lin-35]) I; ieSi64 II. Show Description
ieSi64 [gld-1p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. N-terminal AID*::GFP tag was inserted into the endogenous lin-35 locus. A single copy insertion of gld-1p::TIR1::mRuby allows for auxin inducible degradation of LIN-35 in the germline. Generated in N2 background. Reference: Willis AR, et al. Sci Adv. 2021 May 5;7(19):eabf3114. PMID: 33952520 [NOTE: lin-35(kea7) is an N-terminal tag; the methods section of the paper incorrectly describes the tag as a C-terminal insertion.]
|
|
| AWR58 |
C. elegans |
lin-35(kea7[lin-35p::AID*::GFP::lin-35]) I; keaSi10 II. Show Description
keaSi10 [rpl-28p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. N-terminal AID*::GFP tag was inserted into the endogenous lin-35 locus. A single copy insertion of rpl-28::TIR1::mRuby allows auxin-inducible degradation of LIN-35 throughout the animal. Generated in N2 background. Reference: Willis AR, et al. Sci Adv. 2021 May 5;7(19):eabf3114. PMID: 33952520 [NOTE: lin-35(kea7) is an N-terminal tag; the methods section of the paper incorrectly describes the tag as a C-terminal insertion.]
|
|
| AWR59 |
C. elegans |
keaSi10 II; pals22(kea8[pals-22::GFP::AID*]) III. Show Description
keaSi10 [rpl-28p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. C-terminal GFP::AID* tag was inserted into the endogenous pals-22 locus. A single copy insertion of rpl-28::TIR1::mRuby allows auxin-inducible degradation of PALS-22 throughout the animal. Generated in N2 background. Reference: Willis AR, et al. Sci Adv. 2021 May 5;7(19):eabf3114. PMID: 33952520 [NOTE: pals22(kea8) is a C-terminal tag; the methods section of the paper incorrectly describes the tag as an N-terminal insertion.]
|
|
| AWR61 |
C. elegans |
keaSi11 II; pals22(kea8[pals-22::GFP::AID*]) III. Show Description
keaSi11 [vit-2p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. C-terminal GFP::AID* tag was inserted into the endogenous pals-22 locus. A single copy insertion of vit-2p::TIR1::mRuby allows for auxin inducible degradation in the adult intestine. Generated in N2 background. Reference: Willis AR, et al. Sci Adv. 2021 May 5;7(19):eabf3114. PMID: 33952520 [NOTE: pals22(kea8) is a C-terminal tag; the methods section of the paper incorrectly describes the tag as an N-terminal insertion.]
|
|
| AWR62 |
C. elegans |
keaSi9 II; pals22(kea8[pals-22::GFP::AID*]) III. Show Description
keaSi9 [myo-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. C-terminal GFP::AID* tag was inserted into the endogenous pals-22 locus. A single copy insertion of myo-3p::TIR1::mRuby allows for auxin inducible degradation in the body wall muscles. Generated in N2 background. Reference: Willis AR, et al. Sci Adv. 2021 May 5;7(19):eabf3114. PMID: 33952520 [NOTE: pals22(kea8) is a C-terminal tag; the methods section of the paper incorrectly describes the tag as an N-terminal insertion.]
|
|
| AWR63 |
C. elegans |
keaSi12 II; pals22(kea8[pals-22::GFP::AID*]) III. Show Description
keaSi12 [dpy-7p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. C-terminal GFP::AID* tag was inserted into the endogenous pals-22 locus. A single copy insertion of dpy-7p::TIR1::mRuby allows for auxin inducible degradation in the epidermis. Generated in N2 background. Reference: Willis AR, et al. Sci Adv. 2021 May 5;7(19):eabf3114. PMID: 33952520 [NOTE: pals22(kea8) is a C-terminal tag; the methods section of the paper incorrectly describes the tag as an N-terminal insertion.]
|
|
| AWR64 |
C. elegans |
kea15 II; pals22(kea8[pals-22::GFP::AID*]) III. Show Description
kea15 [rgef-1p::TIR1::mRuby::unc-54 3UTR + Cbr-unc-119(+)] II. C-terminal GFP::AID* tag was inserted into the endogenous pals-22 locus. A single copy insertion of rgef-1p::TIR1::mRuby allows for auxin inducible degradation in neurons. Generated in N2 background. Reference: Willis AR, et al. Sci Adv. 2021 May 5;7(19):eabf3114. PMID: 33952520 [NOTE: pals22(kea8) is a C-terminal tag; the methods section of the paper incorrectly describes the tag as an N-terminal insertion.]
|
|
| AX1789 |
C. elegans |
dbEx719. Show Description
dbEx719 [npr-5::mCherry + unc-122p::GFP]. Pick GFP+ to maintain. mCherry expression in a subset of amphid neurons (ADF, ASE, ASG, ASI, ASJ, ASK, AWA, AWB), in the inner labial neuron IL2, in the interneurons AIA and AUA, and in the phasmids (PHA, PHB). Expression was also seen in head, neck, and body wall muscles. Reference: Cohen M, et al. 2009 Cell Metabolism 9: 375-385.
|
|