Caenorhabditis Genetics Center (CGC)

More Fields
Strain Species Genotype
VC949 C. elegans sas-5&tag-290(gk400) V. Show Description
F35B12.5, F35B12.6. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
GZ491 C. elegans dpy-11(e224) sas-5(t2033) V/nT1 [let-?(m435)] (IV;V). Show Description
VC3975 C. elegans +/nT1 IV; sas-5(gk5038[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/nT1 V. Show Description
Recessive lethal deletion balanced by nT1. Deletion of 1442 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TTCAGCTTCCACAAGAAAGGACAAAACCCC; Right flanking sequence: GGTACCTGAGACTCCAGCTGAACGAGAACG. See WormBase Variation gk5038 for details.
TH61 C. elegans unc-119(ed3) III; ddIs36. Show Description
ddIs36 [pie-1p::GFP::sas-5 + unc-119(+)].