Strain Information
| Name | KB7 View On Wormbase |
|---|---|
| Species | C. elegans |
| Genotype | kgb-1(um3) kgb-2(km16) IV. |
| Description | Deletion alleles. Can be maintained at 20C. Sterile at 26C. Can use PCR with the following primer to determine whether both deletions are present. (5'end)5'GGTCTACCAGAGTTTGTGCGCAATC3' (3'end)5'GATAGCCTTGCACTTCGTTG3'. PCR products from wild type show two bands; kgb-1 gene shows a smaller band; kgb-2 gene shows a bigger band.The double mutant should have no PCR product. [NOTE: The 5' primer sequence was corrected 03/28/12 (K. Bennett)] |
| Mutagen | UV/TMP |
| Outcrossed | x6 |
| Made by | April Orsborn |
| Laboratory | KB |
Sign in
or
register an account if you want to order this strain.