Search Strains

More Fields
Strain Species Genotype Add
EU828 C. elegans dhc-1(or195) I. Show Description
Homozygous or195 hermaphrodites make 100% dead embryos at 26C. One-cell embryo has a very small but bipolar spindle, severe chromosome segregation defect. Maintain at 15C. Previously called spd-4. 2/06: From Bruce Bowerman: The or195 mutation changes base 10,679 of the cosmid clone T21E12 from a C to a T. This corresponds to dhc-1 cDNA nucleotide 9599 (WS153) , which is the center nucleotide of codon 3200. This codon changes from Serine in N2 to Leucine in or195 (S3200L). Note: this is not the same mutation for or195ts that we reported in Hamill et al, 2002(Dev Cell 3, 673-684). The mutation reported in our paper is not present in this strain. We apologize for the confusion. The pairs dhc-11a,b amplify the mutated fragment in dhc-1(or195). The mutation is near the center of this fragment; a clean (gel purified) DNA prep helps get a good read of it. dhc-11b: 5' aacagacgcacgattgacct 3'. dhc-11a: 5' ctcaaatcaaggaaggagct 3'. PCR conditions: 5 min at 94 degrees C; 30 sec at 94 degrees C; 30 sec at 55 degrees C; 1 min at 72 degrees C. 35 Cycles using Taq polymerase.
EU858 C. elegans tbb-2(or362) III. Show Description
Conditional, semi-dominant, maternal-effect, embryonic-lethal mutation. Once-cell stage mitotic embryos have short astral microtubules and a mispositioned mitotic spindle. Maintain at 15C.
EU944 C. elegans tac-1(or455) II. Show Description
Homozygous mutant animals give rise to >99% dead embyros at the restrictive temperature of 26C, with embryos exhibiting a lack of pronuclear migration at the one-cell stage. Homozygous mutant animals give rise to viable progeny at the permissive temperature of 15C. Maintain at 15C.
EW15 C. elegans bar-1(ga80) X. Show Description
[NOTE: (10/22/2020) This strain also carries a (T to A) missense mutation in pry-1 which results in a PRY-1 N354K amino acid substitution.] bar-1(ga80) hermaphrodites are usually Egl and often have a protruding vulva (Pvl), although approx. 40% of animals appear WT on plates. Also slightly Unc. In bar-1(ga80) hermaphrodites any of the six vulval precursor cells (P3.p - P8.p) can sometimes fuse with hyp7 without dividing, and P5.p - P7.p can adopt the tertiary cell fate instead of the primary or secondary fates. In addition, the neuroblast QL and its progeny migrate towards the anterior instead of the posterior, and the cell P12 usually adopts the fate of P11. bar-1(ga80) do mate, but poorly. bar-1 encodes a beta-catenin molecule and the ga80 mutation is predicted to cause an early truncation of the protein.
FAS34 C. elegans his-74(uge18) V. Show Description
Superficially wild-type. Null mutation: premature STOP codon and frame shift. Reference: Delaney K, et al. Genetics. 2018 Apr 10. pii: genetics.300909.2018. doi: 10.1534/genetics.118.300909. [Epub ahead of print].
FF41 C. elegans unc-116(e2310) III. Show Description
Hypomorphic allele. Fully viable and fertile. Strongly uncoordinated larvae, tend to coil backward. Dpyish, mildly Unc adults. Isolated out of a mutator strain also containing uncharacterized e2281 and e2282.
FJ1519 C. elegans cdk-5(gm336) III. Show Description
cdk-5(gm336) mutants exhibit defects in polarized trafficking of dense-core vesicles in motor neurons, and decreased localization of GLR-1::GFP to puncta in ventral nerve cord interneurons. Note that this strain does not contain GLR-1::GFP. References: Juo P, et al. Mol Biol Cell. 2007 Oct;18(10):3883-93. Goodwin PR, et al. J Neurosci. 2012 Jun 13;32(24):8158-72.
FK171 C. elegans mek-1(ks54) sek-1(qd127) X. Show Description
Hypersensitive to copper and cadmium ions, and to starvation. [NOTE: Prior studies suggested possible cross-regulation of PMK-1 by MEK-1, but the identification of a tightly linked partial loss-of-function mutation in sek-1(qd127) in the strain carrying the mek-1(ks54) mutant allele (K. Reddy and D. Kim, unpublished data) suggests that the diminished PMK-1 activation observed in this mutant strain may actually be due to diminished SEK-1 activity.]
FK312 C. elegans sma-5(n678) X. Show Description
Made by crossing MT3353 egl-15(n484) sma-5(n678) with N2 males and selecting animals that grew much better. FK312 probably only carries the sma-5(n678) mutation but that has not been confirmed by sequencing. Small body size, slow growth, abnormal intestinal granules, shorter lifespan than WT.
FT1569 C. elegans unc-119(ed3) III; xnIs371; xnEx385. Show Description
xnIs371 [pie-1p::GFP::pac-1(1-574) + unc-119(+)]. xnEx385 [hsp16p::HA::phplc1(delta)1::hmr-1(ICD-M) + rol-6(su1006)]. Rollers. Rollers express mutated HMR-1 intracellular domain (unable to bind catenins) pan-cortically in cells upon heat shock. Maintain at 15C or 20C to prevent leaky expression of heat shock transgene. Reference: Klompstra D, et al. Nat Cell Biol. 2015 Jun;17(6):726-35.
GA916 C. elegans dyf-x(wu250) I. Show Description
Dyf. Derived by crossing dye-filling mutant wu250 away from geIs3 (LG100 x N2 males). Reference: Burnett C, et al. Nature. 2011 Sep 21;477(7365):482-5.
GE1076 C. elegans pha-1(e2123) III; lon-2(e678) X. Show Description
Long. Maintain at 15C. pha-1(e2123) is a temperature sensitive embryonic lethal. Strain viable only at 15C. lon-2 included to facilitate microinjection. Check regularly for ts lethality-spontaneous sup-35 mutations may occur!
GE1713 C. elegans unc-32(e189) ZK688.9(t1433)/qC1[dpy-19(1259) glp-1(q339)] III; him-3(e1147) IV. Show Description
Maternal-effect lethal mutation linked to unc-32(e189) and balanced by glp-1- and dpy-19-marked recombination suppressor. Heterozygotes are WT, and segregate WT, sterile ts-Dpy qC1 homozygotes, and viable Unc t1433 homozygotes that produce arrested embryos (approximately 100 cells). GE1713 is also homozygous for him-3(e1147) so that male progeny are segregated. Pick WT and check for correct segregation of progeny to maintain. Please reference Li-Leger et al., G3 11(12) 2021 in any work resulting from use of this mutation.
GE1735 C. elegans unc-32(e189) top-3(t1470)/qC1[dpy-19(1259) glp-1(q339)] III; him-3(e1147) IV. Show Description
Maternal-effect lethal mutation linked to unc-32(e189) and balanced by glp-1- and dpy-19-marked recombination suppressor. Heterozygotes are WT, and segregate WT, sterile ts-Dpy qC1 homozygotes, and viable Unc t1470 homozygotes that produce arrested embryos. GE1735 is also homozygous for him-3(e1147) so that male progeny are segregated. Pick WT and check for correct segregation of progeny to maintain. Please reference Li-Leger et al., G3 11(12) 2021 in any work resulting from use of this mutation.
GE1742 C. elegans unc-32(e189) bckd-1A(t1461)/qC1[dpy-19(1259) glp-1(q339)] III; him-3(e1147) IV. Show Description
Maternal-effect lethal mutation linked to unc-32(e189) and balanced by glp-1- and dpy-19-marked recombination suppressor. Heterozygotes are WT, and segregate WT, sterile ts-Dpy qC1 homozygotes, and viable Unc t1461 homozygotes that produce dead eggs. GE1742 is also homozygous for him-3(e1147) so that male progeny are segregated. Pick WT and check for correct segregation of progeny to maintain. Please reference Li-Leger et al., G3 11(12) 2021 in any work resulting from use of this mutation.
GE1936 C. elegans xpf-1(e1487) II; unc-24(e138) atg-7(t1738)/nT1[let (m435)] IV; dpy-11(e224)/nT1[let (m435)] V. Show Description
Maternal effect lethal mutation linked to unc-24(e138) and pseudolinked to dpy-11(e224), and balanced by recessive lethal translocation. Heterozygotes are WT and segregate WT, arrested nT1 aneuploids, arrested nT1 homozygotes, and viable DpyUnc t1738 homozygotes that produce dead embryos. GE1936 is also homozygous for xpf-1(e1487) so that male progeny are segregated. Pick WT and check for correct segregation of progeny to maintain. Please reference Li-Leger et al., G3 11(12) 2021 in any work resulting from use of this mutation. xpf-1 previously known as him-9.
GE1939 C. elegans xpf-1(e1487) II; unc-24(e138) trcs-1(t1745)/nT1[let (m435)] IV; dpy-11(e224)/nT1[let (m435)] V. Show Description
Temperature-sensitive maternal effect lethal mutation linked to unc-24(e138) and pseudolinked to dpy-11(e224), and balanced by recessive lethal translocation. Heterozygotes are WT and segregate WT, arrested nT1 aneuploids, arrested nT1 homozygotes, and viable DpyUnc t1745 homozygotes that produce dead eggs at restrictive temperature. GE1939 is also homozygous for xpf-1(e1487) so that male progeny are segregated. Pick WT and check for correct segregation of progeny to maintain. Please reference Li-Leger et al., G3 11(12) 2021 in any work resulting from use of this mutation. xpf-1 previously known as him-9.
GE1958 C. elegans xpf-1(e1487) II; unc-24(e138) atg-7(t1726)/nT1[let (m435)] IV; dpy-11(e224)/nT1[let (m435)] V. Show Description
Maternal effect lethal mutation linked to unc-24(e138) and pseudolinked to dpy-11(e224), and balanced by recessive lethal translocation. Heterozygotes are WT and segregate WT, arrested nT1 aneuploids, arrested nT1 homozygotes, and viable DpyUnc t1726 homozygotes that produce dead embryos. GE1958 is also homozygous for xpf-1(e1487) so that male progeny are segregated. Pick WT and check for correct segregation of progeny to maintain. Please reference Li-Leger et al., G3 11(12) 2021 in any work resulting from use of this mutation. xpf-1 previously known as him-9.
GE2047 C. elegans xpf-1(e1487) II; unc-24(e138)/nt1[let (m435)] IV; dpy-11(e224) cept-2(t2021)/nt1[let (m435)] V. Show Description
Temperature-sensitive maternal effect lethal mutation linked to dpy-11(e224) and pseudolinked to unc-24(e138), and balanced by recessive lethal translocation. Heterozygotes are WT and segregate WT, arrested nT1 aneuploids, arrested nT1 homozygotes, and viable DpyUnc t2021 homozygotes that produce dead eggs at restrictive temperature. GE2047 is also homozygous for xpf-1(e1487) so that male progeny are segregated. Pick WT and check for correct segregation of progeny to maintain. Please reference Li-Leger et al., G3 11(12) 2021 in any work resulting from use of this mutation. xpf-1 previously known as him-9.
GE2122 C. elegans xpf-1(e1487) II; unc-24(e138)/nt1[let (m435)] IV; dpy-11(e224) cept-2(t2007)/nt1[let (m435)] V. Show Description
Maternal effect lethal mutation linked to dpy-11(e224) and pseudolinked to unc-24(e138), and balanced by recessive lethal translocation. Heterozygotes are WT and segregate WT, arrested nT1 aneuploids, arrested nT1 homozygotes, and viable DpyUnc t2007 homozygotes that produce dead eggs. GE2122 is also homozygous for xpf-1(e1487) so that male progeny are segregated. Pick WT and check for correct segregation of progeny to maintain. Please reference Li-Leger et al., G3 11(12) 2021 in any work resulting from use of this mutation. xpf-1 previously known as him-9.
GE2153 C. elegans xpf-1(e1487) II; unc-24(e138) wapl-1(t1773)/nt1[let (m435)] IV; dpy-11(e224)/nt1[let (m435)] V. Show Description
Maternal effect lethal mutation linked to unc-24(e138) and pseudolinked to dpy-11(e224), and balanced by recessive lethal translocation. Heterozygotes are WT and segregate WT, arrested nT1 aneuploids, arrested nT1 homozygotes, and viable DpyUnc t1773 homozygotes that do not produce viable progeny. GE2153 is also homozygous for xpf-1(e1487) so that male progeny are segregated. Pick WT and check for correct segregation of progeny to maintain. Please reference Li-Leger et al., G3 11(12) 2021 in any work resulting from use of this mutation. xpf-1 previously known as him-9.
GE2200 C. elegans unc-32(e189) bckd-1A(t1480)/qC1[dpy-19(1259) glp-1(q339)] III; him-3(e1147) IV. Show Description
Maternal-effect lethal mutation linked to unc-32(e189) and balanced by glp-1- and dpy-19-marked recombination suppressor. Heterozygotes are WT, and segregate WT, sterile ts-Dpy qC1 homozygotes, and viable Unc t1480 homozygotes that produce dead eggs. GE2200 is also homozygous for him-3(e1147) so that male progeny are segregated. Pick WT and check for correct segregation of progeny to maintain. Please reference Li-Leger et al., G3 11(12) 2021 in any work resulting from use of this mutation.
GE2237 C. elegans unc-32(e189) pod-1(t1614)/qC1[dpy-19(1259) glp-1(q339)] III; him-3(e1147) IV. Show Description
Maternal-effect lethal mutation linked to unc-32(e189) and balanced by glp-1- and dpy-19-marked recombination suppressor. Heterozygotes are WT, and segregate WT, sterile ts-Dpy qC1 homozygotes, and viable Unc t1614 homozygotes that do not produce viable progeny. GE2237 is also homozygous for him-3(e1147) so that male progeny are segregated. Pick WT and check for correct segregation of progeny to maintain. Please reference Li-Leger et al., G3 11(12) 2021 in any work resulting from use of this mutation.
GE2277 C. elegans unc-32(e189) such-1(t1496)/qC1[dpy-19(1259) glp-1(q339)] III; him-3(e1147) IV. Show Description
Maternal-effect lethal mutation linked to unc-32(e189) and balanced by glp-1- and dpy-19-marked recombination suppressor. Heterozygotes are WT, and segregate WT, sterile ts-Dpy qC1 homozygotes, and viable Unc t1496 homozygotes that do not produce viable progeny. GE2277 is also homozygous for him-3(e1147) so that male progeny are segregated. Pick WT and check for correct segregation of progeny to maintain. Please reference Li-Leger et al., G3 11(12) 2021 in any work resulting from use of this mutation.
GE2305 C. elegans xpf-1(e1487) II; unc-24(e138) wapl-1(t1867)/nt1[let (m435)] IV; dpy-11(e224)/nt1[let (m435)] V. Show Description
Maternal effect lethal mutation linked to unc-24(e138) and pseudolinked to dpy-11(e224), and balanced by recessive lethal translocation. Heterozygotes are WT and segregate WT, arrested nT1 aneuploids, arrested nT1 homozygotes, and viable DpyUnc t1867 homozygotes that do not produce viable progeny. GE2305 is also homozygous for xpf-1(e1487) so that male progeny are segregated. Pick WT and check for correct segregation of progeny to maintain. Please reference Li-Leger et al., G3 11(12) 2021 in any work resulting from use of this mutation. xpf-1 previously known as him-9.
GE2335 C. elegans xpf-1(e1487) II; unc-24(e138)/nT1[let (m435)] IV; dpy-11(e224) dlat-1(t2056)/nT1[let (m435)] V. Show Description
Maternal effect lethal mutation linked to dpy-11(e224) and pseudolinked to unc-24(e138), and balanced by recessive lethal translocation. Heterozygotes are WT and segregate WT, arrested nT1 aneuploids, arrested nT1 homozygotes, and viable DpyUnc t2056 homozygotes that produce dead eggs. GE2335 is also homozygous for xpf-1(e1487) so that male progeny are segregated. Pick WT and check for correct segregation of progeny to maintain. Please reference Li-Leger et al., G3 11(12) 2021 in any work resulting from use of this mutation. xpf-1 previously known as him-9.
GE2391 C. elegans xpf-1(e1487) II; unc-24(e138) perm-5(t1932)/nT1[let (m435)] IV; dpy-11(e224)/nT1[let (m435)] V. Show Description
Maternal effect lethal mutation linked to unc-24(e138) and pseudolinked to dpy-11(e224), and balanced by recessive lethal translocation. Heterozygotes are WT and segregate WT, arrested nT1 aneuploids, arrested nT1 homozygotes, and viable DpyUnc t1932 homozygotes that produce dead embryos. GE2391 is also homozygous for xpf-1(e1487) so that male progeny are segregated. Pick WT and check for correct segregation of progeny to maintain. Please reference Li-Leger et al., G3 11(12) 2021 in any work resulting from use of this mutation. xpf-1 previously known as him-9.
GE2399 C. elegans unc-32(e189) top-3(t1559)/qC1[dpy-19(1259) glp-1(q339)] III; him-3(e1147) IV. Show Description
Maternal-effect lethal mutation linked to unc-32(e189) and balanced by glp-1- and dpy-19-marked recombination suppressor. Heterozygotes are WT, and segregate WT, sterile ts-Dpy qC1 homozygotes, and viable Unc t1559 homozygotes that produce arrested embryos. GE2399 is also homozygous for him-3(e1147) so that male progeny are segregated. Pick WT and check for correct segregation of progeny to maintain. Please reference Li-Leger et al., G3 11(12) 2021 in any work resulting from use of this mutation.
GE24 C. elegans pha-1(e2123) III. Show Description
Wild type at 15C. Embryonic lethal at 25C. Temperature sensitive phase during embryogenesis. sup-35 mutations may (and have) occurred spontaneously in this strain. This can be checked by shifting the worms to 25C: pha-1 animals should be dead while sup-35 pha-1 animals will live.
GE2453 C. elegans xpf-1(e1487) II; unc-24(e138) perm-5(t1900)/nT1[let (m435)] IV; dpy-11(e224)/nT1[let (m435)] V. Show Description
Maternal effect lethal mutation linked to unc-24(e138) and pseudolinked to dpy-11(e224), and balanced by recessive lethal translocation. Heterozygotes are WT and segregate WT, arrested nT1 aneuploids, arrested nT1 homozygotes, and viable DpyUnc t1900 homozygotes that produce dead embryos. GE2453 is also homozygous for xpf-1(e1487) so that male progeny are segregated. Pick WT and check for correct segregation of progeny to maintain. Please reference Li-Leger et al., G3 11(12) 2021 in any work resulting from use of this mutation. xpf-1 previously known as him-9.
GE2512 C. elegans xpf-1(e1487) II; unc-24(e138) trcs-1(t1909)/nT1[let (m435)] IV; dpy-11(e224)/nT1[let (m435)] V. Show Description
Leaky temperature-sensitive maternal effect lethal mutation linked to unc-24(e138) and pseudolinked to dpy-11(e224), and balanced by recessive lethal translocation. Heterozygotes are WT and segregate WT, arrested nT1 aneuploids, arrested nT1 homozygotes, and viable DpyUnc t1909 homozygotes that produce dead eggs at restrictive temperature. GE2512 is also homozygous for xpf-1(e1487) so that male progeny are segregated. Pick WT and check for correct segregation of progeny to maintain. Please reference Li-Leger et al., G3 11(12) 2021 in any work resulting from use of this mutation. xpf-1 previously known as him-9.
GE2541 C. elegans xpf-1(e1487) II; unc-24(e138)/nT1[let (m435)] IV; dpy-11(e224) dlat-1(t2035)/nT1[let (m435)] V. Show Description
Maternal effect lethal mutation linked to dpy-11(e224) and pseudolinked to unc-24(e138), and balanced by recessive lethal translocation. Heterozygotes are WT and segregate WT, arrested nT1 aneuploids, arrested nT1 homozygotes, and viable DpyUnc t2035 homozygotes that produce dead eggs. GE2541 is also homozygous for xpf-1(e1487) so that male progeny are segregated. Pick WT and check for correct segregation of progeny to maintain. Please reference Li-Leger et al., G3 11(12) 2021 in any work resulting from use of this mutation. xpf-1 previously known as him-9.
GE2605 C. elegans unc-32(e189) pod-1(t1674)/qC1[dpy-19(1259) glp-1(q339)] III; him-3(e1147) IV. Show Description
Maternal-effect lethal mutation linked to unc-32(e189) and balanced by glp-1- and dpy-19-marked recombination suppressor. Heterozygotes are WT, and segregate WT, sterile ts-Dpy qC1 homozygotes, and viable Unc t1674 homozygotes that do not produce viable progeny. GE2605 is also homozygous for him-3(e1147) so that male progeny are segregated. Pick WT and check for correct segregation of progeny to maintain. Please reference Li-Leger et al., G3 11(12) 2021 in any work resulting from use of this mutation.
GE2621 C. elegans unc-32(e189) ZK688.9(t1587)/qC1[dpy-19(1259) glp-1(q339)] III; him-3(e1147) IV. Show Description
Maternal-effect lethal mutation linked to unc-32(e189) and balanced by glp-1- and dpy-19-marked recombination suppressor. Heterozygotes are WT, and segregate WT, sterile ts-Dpy qC1 homozygotes, and viable Unc t1587 homozygotes that produce arrested embryos. GE2621 is also homozygous for him-3(e1147) so that male progeny are segregated. Pick WT and check for correct segregation of progeny to maintain. Please reference Li-Leger et al., G3 11(12) 2021 in any work resulting from use of this mutation.
GE2666 C. elegans unc-32(e189) such-1(t1693)/qC1[dpy-19(1259) glp-1(q339)] III; him-3(e1147) IV. Show Description
Maternal-effect lethal mutation linked to unc-32(e189) and balanced by glp-1- and dpy-19-marked recombination suppressor. Heterozygotes are WT, and segregate WT, sterile ts-Dpy qC1 homozygotes, and viable Unc t1693 homozygotes that do not produce viable progeny. GE2666 is also homozygous for him-3(e1147) so that male progeny are segregated. Pick WT and check for correct segregation of progeny to maintain. Please reference Li-Leger et al., G3 11(12) 2021 in any work resulting from use of this mutation.
GE2734 C. elegans xpf-1(e1487) II; unc-24(e138)/nt1[let (m435)] IV; dpy-11(e224) C56A3.8(t2029)/nt1[let (m435)] V. Show Description
Maternal effect lethal mutation linked to dpy-11(e224) and pseudolinked to unc-24(e138), and balanced by recessive lethal translocation. Heterozygotes are WT and segregate WT, arrested nT1 aneuploids, arrested nT1 homozygotes, and viable DpyUnc t2029 homozygotes that produce unfertilized oocytes. GE2734 is also homozygous for xpf-1(e1487) so that male progeny are segregated. Pick WT and check for correct segregation of progeny to maintain. Please reference Li-Leger et al., G3 11(12) 2021 in any work resulting from use of this mutation. xpf-1 previously known as him-9.
GE2827 C. elegans xpf-1(e1487) II; unc-24(e138) T22B11.1(t1786)/nt1[let (m435)] IV; dpy-11(e224)/nt1[let (m435)] V. Show Description
Temperature-sensitive maternal effect lethal mutation linked to unc-24(e138) and pseudolinked to dpy-11(e224), and balanced by recessive lethal translocation. Heterozygotes are WT and segregate WT, arrested nT1 aneuploids, arrested nT1 homozygotes, and viable DpyUnc t1786 homozygotes that produce unfertilized oocytes at restrictive temperature. GE2827 is also homozygous for xpf-1(e1487) so that male progeny are segregated. Pick WT and check for correct segregation of progeny to maintain. Please reference Li-Leger et al., G3 11(12) 2021 in any work resulting from use of this mutation. xpf-1 previously known as him-9.
GE2886 C. elegans xpf-1(e1487) II; unc-24(e138)/nt1[let (m435)] IV; dpy-11(e224) C56A3.8(t2055)/nt1[let (m435)] V. Show Description
Maternal effect lethal mutation linked to dpy-11(e224) and pseudolinked to unc-24(e138), and balanced by recessive lethal translocation. Heterozygotes are WT and segregate WT, arrested nT1 aneuploids, arrested nT1 homozygotes, and viable DpyUnc t2055 homozygotes that produce unfertilized oocytes. GE2886 is also homozygous for xpf-1(e1487) so that male progeny are segregated. Pick WT and check for correct segregation of progeny to maintain. Please reference Li-Leger et al., G3 11(12) 2021 in any work resulting from use of this mutation. xpf-1 previously known as him-9.
GE2895 C. elegans xpf-1(e1487) II; unc-24(e138) T22B11.1(t1866)/nt1[let (m435)] IV; dpy-11(e224)/nt1[let (m435)] V. Show Description
Temperature-sensitive maternal effect lethal mutation linked to unc-24(e138) and pseudolinked to dpy-11(e224), and balanced by recessive lethal translocation. Heterozygotes are WT and segregate WT, arrested nT1 aneuploids, arrested nT1 homozygotes, and viable DpyUnc t1866 homozygotes that produce unfertilized oocytes at restrictive temperature. GE2895 is also homozygous for xpf-1(e1487) so that male progeny are segregated. Pick WT and check for correct segregation of progeny to maintain. Please reference Li-Leger et al., G3 11(12) 2021 in any work resulting from use of this mutation. xpf-1 previously known as him-9.
GE337 C. elegans pha-1(e2123) dpy-18(e499) III; sup-37(e2215) V. Show Description
sup-37 suppresses temperature sensitive embryonic lethality of e2123. Strain is viable at 15C and 25C. Dpy. Behavioural mutation leading to avoidance of bacteria (worms tend to concentrate just outside the lawn) unlinked to sup-37.
GE68 C. elegans glp-1(e2144) III. Show Description
Sterile at 25C, maintain at 15C. NOTE (11/16/10 - J. Hubbard): This strain is NOT synonymous with glp-1(e2141) as previously reported in Kodoyianni V, Maine EM, Kimble J. (1992) [Molecular basis of loss-of-function mutations in the glp-1 gene of Caenorhabditis elegans. Mol Biol Cell. 3,1199-213. PMID: 1457827]. As reported in WBG article by Dalfó D, Priess J, Schnabel R and Hubbard J. (2010) [glp-1(e2141) sequence correction. The Worm Breeders Gazette. 18-3.], e2144 carries the mutation c2785t in exon 8, leading to the amino acid change L929F, whereas e2141 carries the mutations c2920t and a3610g in exon 8, leading to the amino acid changes R974C and T1204A.
GL347 C. elegans zcIs13 V. Show Description
zcIs13 [hsp-6p::GFP + lin-15(+)] V. Stable transgenic line with GFP expression mainly in the posterior intestine, observed from L1 to adult. Perturbation of mitochondrial folding environment induces robust GFP expression throughout the intestines. Derived by outcrossing parental strain SJ4100 to N2 six times to remove suspected background mutations causing uneven transgene expression and low penetrance of sterility.
GLW2 C. elegans attf-2(utx2[mNG::attf-2]) V. Show Description
Superficially wild-type. N-terminal tag of ATTF-2 via CRISPR/Cas9 knock-in of mNeonGreen at attf-2 locus. Insertion verified by PCR. Left flank: 5' cttttttgctcacatcatcatttttcagtc 3'; Right flank: 5' ATGTCGGCCGAGACCGCGACTATCCCCGAAGTTTC 3' (5 silent mutations). sgRNA: 5' CGAAACTGCAACCATACCCG 3'
GLW27 C. elegans muIs252 II; unc-119(ed3) his-72(utx21[his-72::wrmScarlet11::3xMyc]) III. Show Description
muIs252 [eft-3p::wrmScarlet1-10::unc-54 3'UTR + Cbr-unc-119(+)] II. C-terminal tag of HIS-72 via CRISPR/Cas9 knock-in of wrmScarlet11 into endogenous his-72 locus. Genetic background: strain CF4582. Insertion verified by PCR and fluorescence. Left flank: 5' CTCGCCAGACGCATTCGCGGAGAACGTGCT 3' (one silent mutation); Right flank: 5' TAAgctccatcaccaattctcgaagcactt 3'; sgRNA: GAGCTTAAGCACGTTCTCCG; Cas9/sgRNA plasmid: pGLOW87; wrmScarlet11^SEC^3xMyc plasmid: pGLOW88; SEC insertion allele strain: GLW26
GLW29 C. elegans muIs252 II; unc-119(ed3) III; egl-1(utx23[egl-1::wrmScarlet11::3xMyc]) V. Show Description
muIs252 [eft-3p::wrmScarlet1-10::unc-54 3'UTR + Cbr-unc-119(+)] II. C-terminal tag of EGL-1 via CRISPR/Cas9 knock-in of wrmScarlet11 into endogenous egl-1 locus. Genetic background: strain CF4582. Insertion verified by PCR, Sanger sequencing, and fluorescence. Left flank: 5' CAGAAGTCTCTTCCATCGTCTTCTGGACTTTTTCGCTTTT 3' (one silent mutation); Right flank: 5' TAAgtgatcaaaatctccaacttttctcca 3'; sgRNA: AGTCCAGAAGACGATGGAAG; Cas9/sgRNA plasmid: pGLOW65; wrmScarlet11^SEC^3xMyc plasmid: pGLOW66; SEC insertion allele strain: GLW28.
GLW39 C. elegans ccdc-47(utx31[mNG::3xFlag::ccdc-47]) III. Show Description
N-terminal tag of CCDC-47 via CRISPR/Cas9 knock-in of mNeonGreen at ccdc-47 locus. Insertion verified by PCR, Sanger sequencing, and fluorescence. Left flank: 5' gttaaatcactcaatttcgggtcgttcacc 3'; Right flank: 5' ATGAAGATAGTATGGATTTTCCTAATATTC 3' (3 silent mutations); sgRNA: cgttcaccATGAAAATCGTC; Cas9/sgRNA plasmid: pGLOW13; mNG^SEC^3xFlag plasmid: pGLOW17; SEC insertion allele strain (balanced): GLW38.
GLW43 C. elegans edc-3(utx35[mNG::3xFlag::edc-3]) I. Show Description
N-terminal tag of EDC-3 via CRISPR/Cas9 knock-in of mNeonGreen at edc-3 locus. Insertion verified by PCR and fluorescence. Left flank: 5' ggttccaattcttctgatttcaaattaaaa 3'; Right flank: 5' ATGGATGACAAACTCATTGGAAGCGTCATCTCTACGGAGACAAAGGACGG 3' (7 silent mutations); sgRNA: ATATCAACCGAAACTAAAGA; Cas9/sgRNA plasmid: pGLOW81; mNG^SEC^3xFlag plasmid: pGLOW103; SEC insertion allele strain: GLW42.
GLW45 C. elegans ZK1058.9(utx37[ZK1058.9::mNG::3xFlag]) III Show Description
C-terminal tag of ZK1058.9 via CRISPR/Cas9 knock-in of mNeonGreen at ZK1058.9 locus. Insertion verified by PCR and fluorescence. Left flank: 5' AGCTCAACGGCTAGCTGGTCTCGTTATTAT 3' (1 silent mutation); Right flank: 5' TAAtgaattttcctccaacttttgtcctct 3'; sgRNA: AATAACGAGACCAGCTAG (18 bp); Cas9/sgRNA plasmid: pGLOW58; mNG^SEC^3xFlag plasmid: pGLOW68; SEC insertion allele strain: GLW44.
GLW47 C. elegans hsp-4(utx39[hsp-4::mNG::3xFlag]) II. Show Description
C-terminal tag of HSP-4 via CRISPR/Cas9 knock-in of mNeonGreen at hsp-4 locus. Insertion verified by PCR and fluorescence. Left flank: 5' TCGGCCGGAGGACAAGGAGAACAAGCTTCTGAGGAGCCATCGGAGGATCATGATGAACTG 3' (1 silent mutation); Right flank: 5' TAAaatattaattgccttcaactacttgct 3'; sgRNA: CGTCTCCAAACTTTACTCGG; Cas9/sgRNA plasmid: pGLOW44; mNG^SEC^3xFlag plasmid: pGLOW61; SEC insertion allele strain: GLW46.
GLW51 C. elegans cey-1(utx43[mNG::3xFlag::cey-1]) II. Show Description
N-terminal tag of CEY-1 via CRISPR/Cas9 knock-in of mNeonGreen at cey-1 locus. Insertion verified by PCR and fluorescence. Left flank: 5' accagaggaagaacagaagcgcgcggaaca 3'; Right flank: 5' ATGGCGGAGAAAAACgtaagtgtgtgtctc 3' (1 silent mutation); sgRNA: acacacacttacGTTTTTCT; Cas9/sgRNA plasmid: pGLOW71; mNG^SEC^3xFlag plasmid: pGLOW93; SEC insertion allele strain (balanced): GLW50.