Search Strains

muIs42[mig-13::GFP + dpy-20(+)]. non-Dpy strain. GFP+ in ventral cord cells, pharyngeal-intestinal valve cells.

Unc. QL descendants in a mutant position (anterior of ALM). Okay to grow at 15 or 20C.

Resistant to levamisole. Egl-d. Twitch at 25C. Long. Throws males.

Males constitutively protract their spicules in the absence of mating cues.

rg551 is an endogenous genomic CRISPR/Cas9 knock in of YFP fused to the C-terminus of the gene pck-2 in N2 background. Robust YFP fluorescence body wall muscle, intestine, hypodermis and pharyngeal muscle. Him. Reference: Goncalves J, et al. iScience 2020 Mar 19;23(4):100990. PMID: 32240955

rg444 is an endogenous genomic CRISPR/Cas9 knock in of YFP fused to the C-terminus of the EGL-2 K+ Channel in N2 background. Faint YFP fluorescent puncta can be detected on muscle membranes and neural cell bodies and processes at high power magnification in all stages. Him. Reference: Goncalves J, et al. iScience 2020 Mar 19;23(4):100990. PMID: 32240955

No longer able to suppress male muscle seizures in the absence of food.

Hyperactive. Small. Spicule protruder. Coiler. Throws males.

rgEx81[pha-1(+) + unc-103 promoter E::unc-103 genomic DNA]. Maintain at 20C.

rgEx161[lev-11p::UNC-43g + gtl-1p::CFP]. rgEx161 rescues unc-43(sy574)-induced spicule protraction.

rgEx173 [unc-103ep::egl-2(cDNA) + gtl-1p::CFP]. Pick animals with cyan fluorescence in their intestines. rgEx173 rescues food deprivation's ability to suppress unc-103(n1213)-induced male sex muscle seizures.

rgEx178 [lev-11p::daf-2(+) + lev-11p::GFP]. rgEx178 rescues food deprivation suppression of unc-103(n1213)-induced spicule protraction.

rgEx180 [aex-3p::daf-2(+) + tnt-4p::GFP]. rgEx180 reduces unc-103(n1213)-induced spicule protraction, and rescues constitutive dauer formation.

rgEx235 [plc-3p::YFP + pha-1(+)]. Expresses YFP from a 4.4bk upstream plc-3 promoter. Maintain at 20C.

rgEx247 [hsp-16p::daf-2(+) + lev-11p::GFP]. rgEx247 restores food-deprivation suppression of unc-103(n1213)-induced spicule protraction.

rgEx251[pha-1(+) + osm-12 promoter:: unc-103(gf)]. Maintain at 20C.

umnIs6 [eft-3p::NLS::tdTomato + HygroR, III:~5753000 (intergenic)] II. Heterozygotes are WT with dim red fluorescence, and segregate WT with dim red fluorescence, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes with more intense red fluorescence), and DpyUnc with no red fluorescence. Pick WT with dim red fluorescence and check for correct segregation of progeny to maintain.

umnIs33 [myo-2p::GFP + NeoR, II: 11755713 (intergenic)] II. Nuclear mScarlet-I was inserted in place of the endogenous lin-4 pre-miRNA via CRISPR/CAS9. Heterozygotes are wild-type mScarlet+ GFP+, and segregate wild-type mScarlet+ GFP+, Lin-4 mScarlet+ non-GFP (umn84 homozygotes), and Dpy non-mScarlet GFP+ (mIn1 homozygotes). Maintain by picking wild-type mScarlet+ GFP+. Left Flanking: AGAGTTTTGGTTGGTTTATGAGTTT, Right Flanking: CCAGGACGGTTTGAGCAGATCtttt. sgRNA: TGAGGTCTCAGGGAACAGGC.

umnIs9 [myo-2p::GFP + NeoR, III:9421936 (intergenic)] V. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+, Unc-36 GFP+ (eT1), dead eggs, and DpyUncs. Maintain by picking wild-type GFP+. Derived by insertion of myo-2p::GFP transgene into eT1 balancer in parental strain BC2200 using CRISPR/Cas9.

umnIs12 [myo-2p::GFP + NeoR, V: 1005689 (intergenic)] III. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+, Unc-36 GFP+ (eT1), dead eggs, and DpyUncs. Maintain by picking wild-type GFP+. Derived by insertion of myo-2p::GFP transgene into eT1 balancer in parental strain BC2200 using CRISPR/Cas9.

umnIs17 [myo-2p::GFP + NeoR, X: 6745526 (intergenic)] I. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+, DpyUnc non-GFP, dead eggs and GFP+ Lon males. Maintain by picking wild-type GFP+. Derived by insertion of myo-2p::GFP transgene into szT1 balancer in parental strain AF1 using CRISPR/Cas9.

umnIs19 [myo-2p::GFP + NeoR, V: 1005689 (intergenic)]. Animals with the Dup are wild-type GFP+; animals that have lost the Dup are Dpy Unc GFP-. Maintain by picking wild-type GFP+. Derived by insertion of myo-2p::GFP transgene into yDp1 duplication in parental strain TY156 using CRISPR/Cas9.

umnIs24 [myo-2p::GFP + NeoR, X: 15420938 (intergenic)] I. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+, DpyUnc non-GFP, dead eggs and GFP+ Lon males. Maintain by picking wild-type GFP+. Derived by insertion of myo-2p::GFP transgene into szT1 balancer in parental strain AF1 using CRISPR/Cas9.

umnIs25 [myo-2p::GFP + NeoR, X: 15420938 (intergenic)]. Pick wild-type GFP+ to maintain. Segregates lethals: homozygous Dp/Dp are lethal. Derived by insertion of myo-2p::GFP transgene into mnDp1 duplication in parental strain SP219 using CRISPR/Cas9.

umnIs26 [myo-2p::GFP + NeoR, X: 15420938 (intergenic)]. Pick wild-type GFP+ to maintain. Segregates wild-type GFP+ and Unc GFP-. Derived by insertion of myo-2p::GFP transgene into mnDp3 duplication in parental strain SP123 using CRISPR/Cas9.

umnIs29 [myo-2p::mKate2 + NeoR, X: 6745526 (intergenic)] I. Heterozygotes are wild-type mKate2+, and segregate wild-type mKate2+, DpyUnc non-GFP, dead eggs and mKate2+ Lon males. Maintain by picking wild-type mKate2+. Derived by insertion of myo-2p::mKate2 transgene into szT1 balancer in parental strain AF1 using CRISPR/Cas9.

umnIs30 [myo-2p::mKate2 + NeoR, X: 6745526 (intergenic)] I. umnIs24 [myo-2p::GFP + NeoR, X: 15420938 (intergenic)] I. Carries szT1 balancer with mKate2 tag on left arm and GFP tag on right arm. Heterozygotes are wild-type GFP+ & mKate2+, and segregate wild-type GFP+ & mKate2+, DpyUnc non-GFP & non-mKate2, dead eggs and GFP+ & mKate2+ Lon males. Maintain by picking wild-type with GFP+ & mKate2+. Derived by insertion of myo-2p::mKate transgene into szT1 balancer in parental strain CGC35 using CRISPR/Cas9.

umnIs31 [myo-2p::GFP + NeoR, X: 15420938 (intergenic)] I. Segregates mostly wild-type GFP+ and occasional Unc GFP-. Maintain by picking WT GFP+. Derived by insertion of myo-2p::GFP transgene into mnDp10 duplication in parental strain SP117 using CRISPR/Cas9.

umnIs32 [myo-2p::GFP + NeoR, II: 11755713 (intergenic)] II. Hets are WT GFP+ and segregate WT GFP+, Unc-4 (GFP-) and paralysed DpyUnc GFP+ (mnC1 homozygotes). Maintain by picking WT GFP+. Derived by insertion of myo-2p::GFP transgene into mnC1 balancer in parental strain SP127 using CRISPR/Cas9.

umnIs33 [myo-2p::GFP + NeoR, II: 11755713 (intergenic)] II. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+, Unc-4 non-GFP, and Dpy GFP+ mIn1 homozygotes. Maintain by picking wild-type GFP+ and check for correct segregation of progeny to maintain. Derived by insertion of myo-2p::GFP transgene into mIn1 balancer in parental strain DR1785 using CRISPR/Cas9.

umnIs34 [myo-2p::GFP + NeoR, III: 8856215 (intergenic)] II. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+, DpyUnc non-GFP, sterile Dpy GFP+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Maintain by picking wild-type GFP+ and check for correct segregation of progeny to maintain. Derived by insertion of myo-2p::GFP transgene into mT1 balancer in parental strain DR1832 using CRISPR/Cas9.

umnIs35 [myo-2p::GFP + NeoR, I: 6284001 (intergenic)] X. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+, DpyUnc non-GFP, dead eggs and GFP+ Lon males. Maintain by picking wild-type GFP+. Derived by insertion of myo-2p::GFP transgene into szT1 balancer in parental strain AF1 using CRISPR/Cas9.

umnIs37 [myo-2p::mKate2 + NeoR, II: 11755713 (intergenic)] II. Hets are WT mKate2+ and segregate WT mKate2+, Unc-4 (no red fluorescence) and paralysed DpyUnc mKate2+ (mnC1). Maintain by picking WT mKate2+. Derived by insertion of myo-2p::mKate2 transgene into parental strain SP127 using CRISPR/Cas9.

umnIs39 [myo-2p::mKate2 + NeoR, X: 6745526 (intergenic)] I. umnIs40 [myo-2p::GFP + NeoR, I: 6284001 (intergenic)] X. Heterozygotes are wild-type GFP+ & mKate2+, and segregate wild-type GFP+ & mKate2+, DpyUnc non-GFP & non-mKate2, dead eggs, and GFP+ & mKate2+ Lon males. Maintain by picking wild-type with GFP+ & mKate2+. Derived by simultaneous insertion of independent myo-2p::mKate2 and myo-2p::GFP transgenes into each portion of the szT1 balancer in parental strain AF1 using CRISPR/Cas9.

umnIs43 [myo-2p::mKate2 + NeoR, II: 11755713 (intergenic)] II. Heterozygotes are wild-type mKate2+, and segregate wild-type mKate2, Unc-4 non-mKate2, and Dpy mKate2+ mIn1 homozygotes. Maintain by picking wild-type mKate2+ and check for correct segregation of progeny to maintain. Derived by insertion of myo-2p::mKate2 transgene into mIn1 balancer in parental strain DR1785 using CRISPR/Cas9.

Homozygous viable. Deletion of 745 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: tgtacccccgatgggattcgaacctgtggc ; Right flanking sequence: gggtatgcaaaatgaccgcgttttctgtga. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs46 [myo-2p::mKate2 + NeoR, III:9421936 (intergenic)] V. Heterozygotes are wild-type mKate+, and segregate wild-type mKate2+, Unc-36 mKate+ (eT1), dead eggs, and DpyUncs. Maintain by picking wild-type mKate2+. Derived by insertion of myo-2p::mKate2 transgene into eT1 balancer in parental strain BC2200 using CRISPR/Cas9.

umnIs50 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)]. Animals with the Dup are wild-type mKate2+; animals that have lost the Dup are Dpy Unc mKate2-. Maintain by picking wild-type mKate2+. Derived by insertion of myo-2p::mKate2 transgene into yDp1 duplication in parental strain TY156 using CRISPR/Cas9.

umnIs51 [myo-2p::mKate2 + NeoR, II: 11755713 (intergenic)] III. Heterozygotes are wild-type mKate2+, and segregate wild-type mKate2+, DpyUnc non-mKate2, sterile Dpy mKate2+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Maintain by picking wild-type mKate2+ and check for correct segregation of progeny to maintain. Derived by insertion of myo-2p::mKate2 transgene into mT1 balancer in parental strain DR1832 using CRISPR/Cas9.

umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Heterozygotes are wild-type mKate2+, and segregate wild-type mKate2+, DpyUnc non-mKate2, sterile Dpy mKate2+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Maintain by picking wild-type mKate2+ and check for correct segregation of progeny to maintain. Derived by insertion of myo-2p::mKate2 transgene into mT1 balancer in parental strain DR1832 using CRISPR/Cas9.

umnIs54 [myo-2p::GFP + NeoR, II: 11755713 (intergenic)] III. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+, DpyUnc non-mGFP, sterile Dpy GFP+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Maintain by picking wild-type GFP+ and check for correct segregation of progeny to maintain. Derived by insertion of myo-2p::GFP transgene into mT1 balancer in parental strain DR1832 using CRISPR/Cas9.

umnIs55 [myo-2p::mKate2 + NeoR, V:1005689 (intergenic)] III. Heterozygotes are wild-type mKate2+, and segregate wild-type mKate2+, Unc-36 mKate+(eT1), dead eggs, and DpyUncs. Maintain by picking wild-type mKate2+. Derived by insertion of myo-2p::mKate2 transgene into eT1 balancer in parental strain BC2200 using CRISPR/Cas9.

umnIs61 [myo-2p::mKate2 + NeoR, X: 15420938 (intergenic)] I. Heterozygotes are wild-type mKate2+, and segregate wild-type mKate2+, DpyUnc non-mKate2, dead eggs and mKate2+ Lon males. Maintain by picking wild-type mKate2+. Derived by insertion of myo-2p::mKate2 transgene into szT1 balancer in parental strain AF1 using CRISPR/Cas9.

umnIs77 [myo-2p::mKate2 + NeoR, I: 6284001 (intergenic)] X. Heterozygotes are wild-type mKate2+, and segregate wild-type mKate2+, DpyUnc non-mKate2, dead eggs and mKate2+ Lon males. Maintain by picking wild-type mKate2+. Derived by insertion of myo-2p::mKate2 transgene into szT1 balancer in parental strain AF1 using CRISPR/Cas9.

Heterozygotes are WT and segregate WT, Dpy Steriles and 3-fold lethals. cg46 is a 497 bp deletion that removes the last 22 nucleotides of intron 9 and 475 nucleotides of exon 10;

Heterozygotes are WT and segregate WT, Dpy Steriles and Uncs which arrest in the L1 stage.

Heterozygotes are WT and segregate WT, DpyUncs, and Ste (and Gon) cg121 homozygotes.

Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.

Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.

Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.