| CHS1124 |
C. elegans |
t06e4.7(yum1724) V; y32h12a.1(yum1726) III; y77e11a.16(yum1725) IV; zk6.6(yum1728) V. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404. |
|
| RB2573 |
C. elegans |
ZK6.7(ok3581) V. Show Description
ZK6.7 Homozygous. Outer Left Sequence: ccaaatggcaagagacctgt. Outer Right Sequence: ctcaaggtgtgaaggtgcaa. Inner Left Sequence: cttcatgcaacacggcct. Inner Right Sequence: agcttgatagccggacgata. Inner Primer PCR Length: 1147. Estimated Deletion Size: about 300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
|
| VC2249 |
C. elegans |
dod-19(ok2679) V. Show Description
ZK6.10. External left primer: ATCTTTGTCCATTGGCTTGC. External right primer: GTCAGTGGCACCAAAATCCT. Internal left primer: CAAACATGGTCTGTGACGCT. Internal right primer: CGTCGCCTTCCTGTATGC. Internal WT amplicon: 1223 bp. Deletion size: 757 bp. Deletion left flank: CGAAATTGTAACGGACACAAATAATTGAAC. Deletion right flank: TAGAAACTGTGCCCATGGGCTTCATATAGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
|
| VC3059 |
C. elegans |
irg-8(ok3738) V. Show Description
ZK6.11. External left primer: ATCAGTCATAAGGCGATGGG. External right primer: CCATTTCAATAAACCGGTCG. Internal left primer: AAGGCTTCAAGGCTGTCAGA. Internal right primer: GTGGCTCGGTTTCACACTTT. Internal WT amplicon: 1209 bp. Deletion size: 496 bp. Deletion left flank: CAGCGTACAGATATGCCAGAGCAGTAGAGT. Deletion right flank: TAAATATTATACGGCGGGTAAACTTTAAAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
|
| VC4808 |
C. elegans |
ZK6.8(gk5876[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) V. Show Description
Homozygous viable. Deletion of 2584 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Please refer to supporting documents linked to the strain name in the CGC Strain Information display. Left flanking sequence: TTAATTTACAGAACTACACAAATGAGCGAA. Right flanking sequence: AGGAATTTTAGATTTGTAATTATATTTTGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
|
| AA107 |
C. elegans |
nhr-48(ok178) X. Show Description
ZK662.3 Homozygous. No obvious phenotype. Outer left primer sequence: TCTGAAGTTTGTGAGCCGTG. Outer right primer sequence: AGCGCCTAGATGAGCAACAT. Inner left primer sequence: TCCGTTGAATGCCATCTGTA. Inner right primer sequence: GGACGATGCACATGAGTTTG. Inner primer PCR product length: 3324 bp. Deletion size: 1956 bp. |
|
| BC10376 |
C. elegans |
dpy-5(e907) I; sEx10376. Show Description
sEx10376 [rCesZK688.6::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). |
|
| BC10385 |
C. elegans |
dpy-5(e907) I; sEx10385. Show Description
sEx10385 [rCes ZK632.3::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). |
|
| BC10700 |
C. elegans |
dpy-5(e907) I; sEx10700. Show Description
sEx10700 [rCesZK632.6::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). |
|
| BC11716 |
C. elegans |
dpy-5(e907) I; sEx11716. Show Description
sEx11716 [rCesZK637.5::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). |
|
| BC12017 |
C. elegans |
dpy-5(e907) I; sEx12017. Show Description
sEx12017 [rCesZK637.10::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). |
|
| BC12401 |
C. elegans |
dpy-5(e907) I; sIs10527. Show Description
sIs10527 [rCes ZK637.11::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). |
|
| BC12551 |
C. elegans |
dpy-5(e907) I; sEx12551. Show Description
sEx12551 [rCes ZK652.8::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). |
|
| BC12886 |
C. elegans |
dpy-5(e907) I; sEx12886. Show Description
sEx12886 [rCes ZK643.8::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). |
|
| BC13932 |
C. elegans |
dpy-5(e907) I; sEx13932. Show Description
sEx13932[rCesZK652.2::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). |
|
| BC14566 |
C. elegans |
dpy-5(e907) I; sEx14566. Show Description
sEx14566 [rCesZK632.12::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). |
|
| BC14626 |
C. elegans |
dpy-5(e907) I; sEx14626. Show Description
sEx14626 [rCes ZK652.3::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). |
|
| BC14831 |
C. elegans |
dpy-5(e907) I; sEx14831. Show Description
sEx14831 [rCes ZK688.8::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). |
|
| BC14900 |
C. elegans |
dpy-5(e907) I; sEx14900. Show Description
sEx14900 [rCes ZK632.4::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). |
|
| BC15054 |
C. elegans |
dpy-5(e907) I; sEx15054. Show Description
sEx15054 [rCes ZK697.7::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). |
|
| BC15259 |
C. elegans |
dpy-5(e907) I; sEx15259. Show Description
sEx15259 [rCes ZK688.2::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). |
|
| BC16072 |
C. elegans |
dpy-5(e907) I; sEx16072. Show Description
sEx16072 [rCes ZK697.4::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). |
|
| BC16083 |
C. elegans |
dpy-5(e907) I; sEx16083. Show Description
sEx16083[rCesZK652.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). |
|
| BC16132 |
C. elegans |
dpy-5(e907) I; sEx16132. Show Description
sEx16132[rCesZK688.6a::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). |
|
| BC4542 |
C. elegans |
sEx29. Show Description
sEx29 [ZK652 (III) + pCes1943[rol-6(su1006)]]. Cosmid ZK652 and plasmid pCes1943 were injected into hermaphrodite from N2 strain. pCes1943 carries rol-6(su1006) [an EcoRI insert from pRF4] and a kanamycin cassette. Select Rollers to maintain. Presence of cosmid confirmed by PCR. This transgenic strains were constructed in collaboration with the C. elegans Genome Sequencing Consortium Labs in St. Louis, MO and Hinxton, Cambridge, UK. Funding for the creation of this transgenic strain was provided by a grant to Ann Rose and David Baillie from the Canadian Genome Analysis and Technology Program (CGAT), and from a grant from NSERC (Canada) to David Baillie. If you use this strain in work which you publish, please acknowledge these grants. |
|
| BC4544 |
C. elegans |
sEx31. Show Description
sEx31 [ZK688 (III) + pCes1943[rol-6(su1006)]]. Cosmid ZK688 and plasmid pCes1943 were injected into hermaphrodite from N2 strain. pCes1943 carries rol-6(su1006) [an EcoRI insert from pRF4] and a kanamycin cassette. Select Rollers to maintain. Presence of cosmid confirmed by PCR. This transgenic strains were constructed in collaboration with the C. elegans Genome Sequencing Consortium Labs in St. Louis, MO and Hinxton, Cambridge, UK. Funding for the creation of this transgenic strain was provided by a grant to Ann Rose and David Baillie from the Canadian Genome Analysis and Technology Program (CGAT), and from a grant from NSERC (Canada) to David Baillie. If you use this strain in work which you publish, please acknowledge these grants. |
|
| BC5038 |
C. elegans |
sEx206. Show Description
sEx206 [ZK637 (III) + pCes1943[rol-6(su1006)]]. segrgnt 2. 6 ng/ul ZK637 + 100 ng/ul pCes1943[rol-6(su1006dm)] injected into hermaphrodite from BC842 (N2 male strain). pCes1943 carries rol-6(su1006) [an EcoRI insert from pRF4] and a kanamycin cassette. Select Rollers to maintain. Presence of cosmid confirmed by PCR. This transgenic strains were constructed in collaboration with the C. elegans Genome Sequencing Consortium Labs in St. Louis, MO and Hinxton, Cambridge, UK. Funding for the creation of this transgenic strain was provided by a grant to Ann Rose and David Baillie from the Canadian Genome Analysis and Technology Program (CGAT), and from a grant from NSERC (Canada) to David Baillie. If you use this strain in work which you publish, please acknowledge these grants. |
|
| CB6503 |
C. elegans |
bgIs312 I; him-8(e1489) IV; bus-17(e2923) X. Show Description
bgIs312 [pes-6::GFP]. GFP expression in excretory cell only. Bus (resistant to infection by M. nematophilum and Leucobacter Verde2), hypersensitive to Leucobacter Verde1, bleach-sensitive, drug-sensitive; Him (high incidence of males). e2923 is a Mos1 insertion in bus-17 (ZK678.8). Reference: Yook & Hodgkin (2007), Genetics 175: 681-697 |
|
| DM7118 |
C. elegans |
raEx118. Show Description
raEx118 [T05G5.1p::ZK637.3 ORF(cDNA)::GFP + rol-6(su1006)]. Wild-type background with extrachromosomal array carrying dominant rol-6 and cDNA::GFP fusion driven by muscle promoter (T05G5.1). Maintain by picking Rol-6 animals. WBPaper00038444. |
|
| DM7234 |
C. elegans |
pha-1(e2123) III; raEx342. Show Description
raEx342 [T05G5.1p::ZK637.2(cDNA)::GFP + pha-1(+) + rol-6]. Temperature-sensitive pha-1 mutant rescued by extrachromosomal array carrying pha-1(+), dominant rol-6, and cDNA::GFP fusion driven by muscle promoter (T05G5.1). Grow at 25 degrees to maintain. At 15 degrees maintain by picking Rol-6 animals. WBPaper00038444. |
|
| DM7393 |
C. elegans |
pha-1(e2123) III; raEx393. Show Description
raEx393 [T05G5.1p::ZK643.1(cDNA)::GFP + pha-1(+) + rol-6(su1006)]. Temperature-sensitive pha-1 mutant rescued by extrachromosomal array carrying pha-1(+), dominant rol-6, and cDNA::GFP fusion driven by muscle promoter (T05G5.1). Grow at 25 degrees to maintain. At 15 degrees maintain by picking Rol-6 animals. WBPaper00038444. |
|
| FF276 |
C. elegans |
dpy-17(e164) unc-32(f121) ncl-1(e1865)/qC1 [dpy-19(e1259) glp-1(q339)] III. Show Description
Heterozygotes are WT and segregate WT, Dpy Steriles (qC1 homozygotes), and larval lethals (f121 homozygotes). g to a transition in exon 6 (2874), changing a Gly in Glu in ZK637.8 gene encoding a V-ATPase alpha subunit |
|
| FF451 |
C. elegans |
unc-32(f131) III. Show Description
Extreme coiler from L1 to adult. Hypomorph. f131/nDf17 is L1 lethal. Molecular lesion: g to a transition in splice donor site of exon 6 (g3485a) in ZK637.8 gene encoding a V-ATPase alpha subunit. |
|
| GE1713 |
C. elegans |
unc-32(e189) ZK688.9(t1433)/qC1[dpy-19(1259) glp-1(q339)] III; him-3(e1147) IV. Show Description
Maternal-effect lethal mutation linked to unc-32(e189) and balanced by glp-1- and dpy-19-marked recombination suppressor. Heterozygotes are WT, and segregate WT, sterile ts-Dpy qC1 homozygotes, and viable Unc t1433 homozygotes that produce arrested embryos (approximately 100 cells). GE1713 is also homozygous for him-3(e1147) so that male progeny are segregated. Pick WT and check for correct segregation of progeny to maintain. Please reference Li-Leger et al., G3 11(12) 2021 in any work resulting from use of this mutation. |
|
| GE2621 |
C. elegans |
unc-32(e189) ZK688.9(t1587)/qC1[dpy-19(1259) glp-1(q339)] III; him-3(e1147) IV. Show Description
Maternal-effect lethal mutation linked to unc-32(e189) and balanced by glp-1- and dpy-19-marked recombination suppressor. Heterozygotes are WT, and segregate WT, sterile ts-Dpy qC1 homozygotes, and viable Unc t1587 homozygotes that produce arrested embryos. GE2621 is also homozygous for him-3(e1147) so that male progeny are segregated. Pick WT and check for correct segregation of progeny to maintain. Please reference Li-Leger et al., G3 11(12) 2021 in any work resulting from use of this mutation. |
|
| NL243 |
C. elegans |
mut-2(r459) I; ZK637.13(pk42) III. Show Description
insertion: TTCTGTGAAC TA TGTCAAAAT |
|
| PS8785 |
C. elegans |
ZK637.2(sy1518) III. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of ZK637.2.
Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette).
left flanking sequence: CGATGAGATGATTGACGATTTGGATAAGACCTATT
right flanking sequence: TGAGGGATATGCAGAAGAGCATGTTTCAGTGCTCAG
inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: CTTCTGCATATCCCTCAAAT
Method Reference: G3 (Bethesda). |
|
| RB1247 |
C. elegans |
ZK669.1a(ok1311) II. Show Description
ZK669.1a Homozygous. Outer Left Sequence: atgaactgtgcacgcttttg. Outer Right Sequence: attggattctggattgcgag. Inner Left Sequence: tcgttcgactacgctttcct. Inner Right Sequence: aaagccagttttcgtcatgc. Inner Primer PCR Length: 3252. Estimated Deletion Size: about 2600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
|
| RB1353 |
C. elegans |
spv-1(ok1498) II. Show Description
ZK669.1a Homozygous. Outer Left Sequence: atcggtgttggctctacgtc. Outer Right Sequence: aggagctcttccagacacca. Inner Left Sequence: gaaatcctcttctgcggttg. Inner Right Sequence: gagttatgccggtcgaacat. Inner Primer PCR Length: 2929. Estimated Deletion Size: about 1050 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
|
| RB1764 |
C. elegans |
trxr-2(ok2267) III. Show Description
ZK637.10. Homozygous. Outer Left Sequence: GCGAATATCCGATAGCGATT. Outer Right Sequence: CAAGACCCTTCCAAACCAAA. Inner Left Sequence: CCAATCAGGCGTCTCTTCTC. Inner Right Sequence: GCTCAAAGCCTGTTCAATCC. Inner Primer PCR Length: 3171 bp. Deletion Size: 1649 bp. Deletion left flank: TTGTAATTGGAGCAGGATCTGGAGGACTTT. Deletion right flank: TAAGGATAGCGGTTTTTGTTATGTGAAAGC. Insertion Sequence: TTTGTAGCGGTTTTG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
|
| RB1861 |
C. elegans |
arl-5(ok2407) III. Show Description
ZK632.8. Homozygous. Outer Left Sequence: GACAAGTCATTCCGCGATTT. Outer Right Sequence: TCGTCCAACAAATGATCGAA. Inner Left Sequence: GTTGCACCGCTAAACCCTAA. Inner Right Sequence: GCCAGAAGAAAGTGAGCCAG. Inner Primer PCR Length: 2126 bp. Deletion Size: 1199 bp. Deletion left flank: TCTTCCCGTTCTTTTTTATTCAAACTTATG. Deletion right flank: ATATTAAAATTAAAATTATTTTCAGTTATT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
|
| RB1988 |
C. elegans |
spe-17(ok2623) IV. Show Description
ZK617.3. Homozygous. Outer Left Sequence: TGCTGCACCTAACAATCAGC. Outer Right Sequence: CAAGCGAACAGCAGTCACAT. Inner Left Sequence: GCTTGAATTTTTGACTGTGGC. Inner Right Sequence: GTTGTCGAATTATTGCGGCT. Inner Primer PCR Length: 1167 bp. Deletion Size: 285 bp. Deletion left flank: GGTAATCTCTAGTTGTCTTCCAGTTTCAGT. Deletion right flank: CTCGGAAGTTGAGAACGTGGCGGCCACGAC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
|
| RB2081 |
C. elegans |
ZK637.13(ok2747) III. Show Description
ZK637.13 Homozygous. Outer Left Sequence: gaaaaactcgtcgaagccac. Outer Right Sequence: gaagtttcaggggttgagca. Inner Left Sequence: cgaattctaaaaaggcgacg. Inner Right Sequence: tttccatctttacccaaccc. Inner Primer PCR Length: 3001. Deletion size: about 2200 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
|
| RB2181 |
C. elegans |
ZK643.3(ok2957) III. Show Description
ZK643.3. Homozygous. Outer Left Sequence: AACTCGCAAAGCTCCAAAAA. Outer Right Sequence: TCGCTTCAAGACCCAGTACC. Inner Left Sequence: CTATTCTAACGGCTCGCCAA. Inner Right Sequence: CCGATCCATTTCAATTTGCT. Inner Primer PCR Length: 1177 bp. Deletion Size: 534 bp. Deletion left flank: CTCATCTCATGTCTCTTATACGGAGCATTC. Deletion right flank: ATAGAATTCCAAGCATTGGATAATGATTAA. Insertion Sequence: . Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
|
| RB2182 |
C. elegans |
ZK632.3(ok2958) III. Show Description
ZK632.3. Homozygous. Outer Left Sequence: CGCTCATCGTCAGTGAAAAA. Outer Right Sequence: GTCAGTTTTGCGGATGTCCT. Inner Left Sequence: CCCATTCCACGTTTTTGAGT. Inner Right Sequence: ACTTGCTCTTCAACGCCATT. Inner Primer PCR Length: 1108 bp. Deletion Size: 371 bp. Deletion left flank: GCCGACCATATCGCCTGTTGGAAGGGTGTT. Deletion right flank: AAGACGAGAATTCGTTGCATTTTCCTCATC. Insertion Sequence: TCCCTTCCAAC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
|
| RB2293 |
C. elegans |
ZK632.9(ok3116) III. Show Description
ZK632.9 Homozygous. Outer Left Sequence: cgaacatttcgtcatctcca. Outer Right Sequence: cgtctgctgttgattcgcta. Inner Left Sequence: ccaataaatcctagcggacg. Inner Right Sequence: aaagaaatctctacgccacaca. Inner Primer PCR Length: 1179. Deletion size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
|
| RB2399 |
C. elegans |
grl-25(ok3279) III. Show Description
ZK643.8 Homozygous. Outer Left Sequence: gaggatcgtcttattccggc. Outer Right Sequence: gagaccttgctctccacagg. Inner Left Sequence: gaggagaagcatcatcgtca. Inner Right Sequence: cgagatttgacacgttgagc. Inner Primer PCR Length: 1236. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
|
| RB2553 |
C. elegans |
ZK669.2(ok3558) II. Show Description
ZK669.2 Homozygous. Outer Left Sequence: catcgagccatgctgaaata. Outer Right Sequence: ccatccgaacttccgaacta. Inner Left Sequence: tgcaactgatcattccttga. Inner Right Sequence: tccgactgaatcagacatcg. Inner Primer PCR Length: 1347. Estimated Deletion Size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
|
| RB647 |
C. elegans |
cdc-25.3(ok358) III. Show Description
ZK637.11. Homozygous. Strain grows better at 15 degrees. Outer Left Sequence: GTTCCTTCTCTAATCCCCGC . Outer Right Sequence: GTTTTTGATTCGCAGGTGGT. Inner Left Sequence: GTTTTCTGTCCACTTCCCGA. Inner Right Sequence: CCCACAATGAGACGAGTGTG . Inner primer WT PCR product: 2592. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
|
| RB747 |
C. elegans |
hlh-10(ok516) V. Show Description
ZK682.4. Homozygous. Outer Left Sequence: CAATTCTCACGCCAAGATCA. Outer Right Sequence: CCGTCTCTTTCACCACCACT. Inner Left Sequence: AAGCATCCCTGATTGATTGG. Inner Right Sequence: CTGAAAGAAGCCGAATCACC. Inner primer WT PCR product: 2674. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
|