Search Strains

mIs14 [myo-2::GFP]. Heterozygotes are WT and GFP+ with signal in the pharynx. Heterozygote animals segregate heterozygotes (WT GFP+), mIn1 homozygotes (Dpy and brighter GFP+), and rsr-2(tm2625) homozygotes (Lva non-GFP). Pick WT GFP+ animals and check for proper segregation of progeny to maintain. Reference: Fontrodona L, et al. PLoS Genet. 2013 Jun;9(6):e1003543.

Endogenous sftb-1 reporter generated by CRISPR/Cas9 using the Nested CRISPR protocol (Vicencio et al., 2019 Genetics). mCherry was amplified from pJJR83 plasmid and inserted at the 5' end of the sftb-1 gene. External primers used for genotyping: (For: AGCTATCGAAGTTTAGGATGTTGTT) (Rev: CGGTTCCAATCGAGTCTAGGTA) Reference: Serrat X, et al. PLoS Genet. 2019 Oct 21;15(10):e1008464.

Homozygous viable mutation balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP cer140 gk401 homozygotes (synthetic sterile). Pick WT dim GFP and check for correct segregation of progeny to maintain. Generated by CRISPR-mediated deletion of ubh-4 in gk401 mutant background. Reference: Martinez-Fernandez C, et al. Cells. 2023 Mar 18;12(6):929. doi: 10.3390/cells12060929. PMID: 36980270

Dose-dependent sensitivity (developmental arrest) to pladienolide B and herboxidiene (modulators of pre-mRNA splicing). sftb-1(cer144[S1090A, A1095T, I1096V, F1101Y]) contains four missense mutations reproducing the HEAT repeat 15 of the human SF3B1 protein. Ten silent mutations increase primer specificity for PCR genotyping. Primers used for genotyping: (WT For: GAGCTGCAATTAATACATTTGGATTT) (WT Rev: AAACTCGCATTCCTTCACAT) (cer144 For: GGTACTATTCTGTGGCGTCT) (cer144 Rev: GTAACCGAAAGTGTTCACAGTT) Reference: Serrat X, et al. PLoS Genet. 2019 Oct 21;15(10):e1008464.

Missense mutations D1135L and S1136W, G1218K and E1219Q, and R1335Q and T1337R were introduced on the Cas9 gene at EG9615 strain, to cause endogenous expression of the Cas9 variant SpG. SpG is efficient for CRISPR on NGN PAM sites. Reference: Vicencio J, et al. Nature Communication, 2022. May 12;13(1):2601. doi: 10.1038/s41467-022-30228-4.

Superficially wild-type. tm2607 is a 196 bp deletion + 1bp insertion that removes part of an essential gene, but produces viable animals. Reference: Fontrodona L, et al. PLoS Genet. 2013 Jun;9(6):e1003543.

muIs61 [daf-16a::GFP + rol-6(su1006)]. Temperature-sensitive. Maintain at 15 C. Rollers. Reference: Lin K, Hsin H, Libina N, Kenyon C. Nat Genet. 2001 Jun;28(2):139-45.

Rollers. lin-22 and him-5 mutations affect neuroblast formation from epidermal precursor cell V5.

muEx108 [(pKL99-2) daf-16::GFP/daf16bKO + rol-6(su1006)]. Grows okay at 20C. Rollers should form dauers at 25C. Pick Rollers to maintain.

muEx158 [daf-16cAM::GFP + sur-5p::GFP] (AM = AKT-site mutant). Pick GFP+ worms to maintain. Sterile at 25C; grow at 20C or less. muEx158 contains GFP-tagged daf-16 c isoform (described as a1 isoform in Lin, et al. Nat Genet. 2001) with 4 Ser/Thr residues mutated to Ala, which completely rescues dauer formation and partially restores longevity of daf-16; daf-2 double mutants. Reference: Lin K, et al. Nat Genet. 2001 Jun;28(2):139-45.

muEx169 [unc-119p::GFP::daf-16 + rol-6(su1006)]. Pick Rollers to maintain. May grow better at 15C.

muEx176 [daf-16p::GFP::daf-16 + rol-6(su1006)]. Pick rollers to maintain -- Low transmission rate! Maintain at 15C. Forms dauers at 25C. Reference: Lin K, et al. Nat Genet. 2001 Jun;28(2):139-45.

muEx211[pNL213(ges-1p::GFP::daf-16) + rol-6(su1006)]. Grows at 15C (probably also at 20C). Pick Rollers to maintain.

muEx212[pNL212(myo-3p::GFP::daf-16) + rol-6(su1006)]. Grows at 15C (probably also at 20C). Pick Rollers to maintain.

muIs84 [(pAD76) sod-3p::GFP + rol-6(su1006)]. Green expression in head, tail and around vulva. Daf-C at 25C. Grows well at 20C.

muIs84 [(pAD76) sod-3p::GFP + rol-6(su1006)]. Dim green expression in head, tail and around vulva. Daf-d. Can grow at 20C.

muEx227 [(pNL213) ges-1p::GFP::daf-16) + rol-6(su1006)]. Pick Rollers to maintain.

muIs84 [(pAD76) sod-3p::GFP + rol-6(su1006)]. muEx211 [ges-1p::daf-16::GFP + rol-6(su1006)]. Pick Rollers to maintain. Partial rescue of lifespan phenotype. Some animals show variable daf-16 expression in the intestine. Grows okay at 15C. [NOTE: muEx211 is quite unstable. Be sure to pick Rollers to avoid losing the array.]

muIs105 [daf-16p::GFP::daf-16 + rol-6(su1006)]. Rollers; Rol phenotype is not always evident). Integrated line derived from CF1449. Maintain at 15C. Forms dauers at 25C. Reference: Lin K, et al. Nat Genet. 2001 Jun;28(2):139-45.

Daf-c at 25.5C; grow at 20C or less. Long lived.

muEx268 [ges-1p::GFP::daf-16(cDNA) + odr-1::RFP]. daf-16 GFP expressed in intestine. Partial rescue of lifespan phenotype. Grows okay at 15C. Pick RFP to maintain.

Daf-c at 25.5C; grow at 20C or less. Long lived.

muIs120 [ges-1p::GFP::daf-16 + rol-6(su1006)]. Maintain at 15-20C. Rollers. Long-lived. Gamma irradiation-induced integration of muEx211. Rescues daf-16a1/c in the intestine (described in Libina et al, 2003). Reference: Zhang P, et al. Cell Metab, 2013. 17(1): p. 85-100.

muEx306 [tcer-1::GFP + odr-1::RFP]. Maintain by picking RFP+ animals. Reference: Gahzi A, et al. PLoS Genet. 2009 Sep;5(9):e1000639.

muIs131 [unc-119p::GFP::daf-16 + rol-6(su1006)]. Maintain at 15-20C. Rollers. Modestly long-lived. Gamma irradiation-induced integration of muEx184. Rescues daf-16a1/c in neurons (described in Libina et al, 2003). Reference: Zhang P, et al. Cell Metab, 2013. 17(1): p. 85-100.

muIs126 [myo-3p::GFP::daf-16 + rol-6(su1006)]. Maintain at 15-20C. Rollers. Gamma irradiation-induced integration of muEx215. Rescues daf-16a1/c in muscles (described in Libina et al, 2003). Reference: Zhang P, et al. Cell Metab, 2013. 17(1): p. 85-100.

Temperature sensitive sterile at 25C. tcer-1(-) causes loss of germ cells and increases lifespan. Reference: Ghazi A, Henis-Korenbilt S, & Kenyon C (2009) PLoS Genet 5(9):e1000639.

Temperature sensitive sterile at 25C. tcer-1(-) causes loss of germ cells and increases lifespan. Reference: Ghazi A, Henis-Korenbilt S, & Kenyon C (2009) PLoS Genet 5(9):e1000639.

Abnormal large nucleoli in most cells.

muIs2 [mab-5::lacZ + unc-31(+)]. non-Unc.

Catecholamine abnormal. Throws males.

muIs142 [ges-1p::GFP::daf-16(cDNA) + odr-1p::RFP]. Maintain at 15-20C. Gamma irradiation-induced integration of muEx268. Rescues daf-16a1/c in the intestine (described in Libina et al, 2003). Reference: Zhang P, et al. Cell Metab, 2013. 17(1): p. 85-100.

Alae-to-ray transformation similar to that of n372 animals.

muIs9 [hs-mab-5 + C14G10]. Heat-shock inducible mab-5. C14G10 contains a WT copy of unc-31. muIs9 integrated by gamma irradiation.

Alae-to-ray transformation similar to that of n372 animals.

muEx473 [kin-19p::kin-19::tagRFP + tph-1p::GFP]. Pick RFP+ GFP+ animals to maintain. Low transmission rate. Translational fusion of KIN-19 displaying age-dependent aggregation. Reference: David DC, et al. PLoS Biol. 2010 Aug 10;8(8):e1000450.

Very slow growth.

agIs6 [dod-24p::GFP]. Derived by outcrossing AU68 3 times to the Kenyon lab N2 strain. Reference: Yamawaki TM, et al. PLoS Biol. 2010 Aug 31;8(8). pii: e1000468.

muIs209 [myo-3p::kin-19::tagRFP + tph-1p::GFP]. KIN-19::tagRFP aggregates with age in body-wall muscles. Animals have reduced thrashing compared to controls. Generated in N2 background. References: Huang YC, et al. Elife. 2019 May 3;8. pii: e43059. doi: 10.7554/eLife.43059. David DC, et al. PLoS Biol. 2010 Aug 10;8(8):e1000450.

muIs23 [hsp::lin-39 + (pMH86) dpy-20(+)]. Heat-shock inducible lin-39. muIs23 is a spontaneous integrant whose chromosomal location is unknown. [NOTE: This strain was previously described as carrying lin-39(n1760), but it is actually carrying the g to a substitution of mu26. Strain MT7255 has been confirmed to be carrying the a to t substitution of n1760.]

muIs16 [mab-5::GFP + dpy-20(+)]. non-Dpy.

Very sick, Muv, Scrawny. Extra rays in males in body. Ectopic expression of lin-39, mab-5, egl-5. Cold sensitive - grows better at 25C.

muIs27 [mig-2::GFP + dpy-20(+)]. Him. non-Dpy. GFP is membrane enriched and expressed in many cells throughout development (see reference for details). Not known in which LG muIs27 is integrated.

mab-5 mutation affects ectodermal and mesodermal lineages. lin-22 and him-5 mutations affect neuroblast formation from the epidermal precursor cell V5.

muIs28 [mig-2::GFP + unc-31(+)]. muIs28 is not mapped, but probably on LG II by process of elimination.

muIs37 [(pMS114) hsp::mig-13 + (pMH86) dpy-20(+)]. Inducible heat-shock promoter driven mig-13 rescues Q cell migration defects in mig-13(mu31) mutants. Reference: Sym, M., Robinson, N., and Kenyon, C. Cell. 1999 Jul 9;98(1):25-36.

Abnormal V rays (male).

In males, P7.p and P8.p fail to fuse with hyp7 at the end of L1. Dominant. him-5 allele is either e1467 or e1490.

muIs37 [(pMS114) hsp::mig-13 + (pMH86) dpy-20(+)]. Inducible heat-shock promoter driven mig-13 rescues Q cell migration defects in mig-13(mu31) mutants. Reference: Sym, M., Robinson, N., and Kenyon, C. Cell. 1999 Jul 9;98(1):25-36.