Search Strains

More Fields
Strain Species Genotype Add
CER4 C. elegans rsr-2(tm2625)/mIn1 [dpy-10(e128) mIs14] II. Show Description
mIs14 [myo-2::GFP]. Heterozygotes are WT and GFP+ with signal in the pharynx. Heterozygote animals segregate heterozygotes (WT GFP+), mIn1 homozygotes (Dpy and brighter GFP+), and rsr-2(tm2625) homozygotes (Lva non-GFP). Pick WT GFP+ animals and check for proper segregation of progeny to maintain. Reference: Fontrodona L, et al. PLoS Genet. 2013 Jun;9(6):e1003543.
CER444 C. elegans sftb-1(cer114[mCherry::sftb-1]) III. Show Description
Endogenous sftb-1 reporter generated by CRISPR/Cas9 using the Nested CRISPR protocol (Vicencio et al., 2019 Genetics). mCherry was amplified from pJJR83 plasmid and inserted at the 5' end of the sftb-1 gene. External primers used for genotyping: (For: AGCTATCGAAGTTTAGGATGTTGTT) (Rev: CGGTTCCAATCGAGTCTAGGTA) Reference: Serrat X, et al. PLoS Genet. 2019 Oct 21;15(10):e1008464.
CER522 C. elegans ubh-4(cer140) rpn-9(gk401)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
Homozygous viable mutation balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP cer140 gk401 homozygotes (synthetic sterile). Pick WT dim GFP and check for correct segregation of progeny to maintain. Generated by CRISPR-mediated deletion of ubh-4 in gk401 mutant background. Reference: Martinez-Fernandez C, et al. Cells. 2023 Mar 18;12(6):929. doi: 10.3390/cells12060929. PMID: 36980270
CER529 C. elegans sftb-1(cer144) III. Show Description
Dose-dependent sensitivity (developmental arrest) to pladienolide B and herboxidiene (modulators of pre-mRNA splicing). sftb-1(cer144[S1090A, A1095T, I1096V, F1101Y]) contains four missense mutations reproducing the HEAT repeat 15 of the human SF3B1 protein. Ten silent mutations increase primer specificity for PCR genotyping. Primers used for genotyping: (WT For: GAGCTGCAATTAATACATTTGGATTT) (WT Rev: AAACTCGCATTCCTTCACAT) (cer144 For: GGTACTATTCTGTGGCGTCT) (cer144 Rev: GTAACCGAAAGTGTTCACAGTT) Reference: Serrat X, et al. PLoS Genet. 2019 Oct 21;15(10):e1008464.
CER660 C. elegans cer227[mex-5p::SpG(smu-2 introns) + unc-119(+)] II; unc-119(ed3) III. Show Description
Missense mutations D1135L and S1136W, G1218K and E1219Q, and R1335Q and T1337R were introduced on the Cas9 gene at EG9615 strain, to cause endogenous expression of the Cas9 variant SpG. SpG is efficient for CRISPR on NGN PAM sites. Reference: Vicencio J, et al. Nature Communication, 2022. May 12;13(1):2601. doi: 10.1038/s41467-022-30228-4.
CER7 C. elegans rsr-2(tm2607) II. Show Description
Superficially wild-type. tm2607 is a 196 bp deletion + 1bp insertion that removes part of an essential gene, but produces viable animals. Reference: Fontrodona L, et al. PLoS Genet. 2013 Jun;9(6):e1003543.
CF1137 C. elegans daf-16(mu86) I; daf-2(e1370) III; muIs61. Show Description
muIs61 [daf-16a::GFP + rol-6(su1006)]. Temperature-sensitive. Maintain at 15 C. Rollers. Reference: Lin K, Hsin H, Libina N, Kenyon C. Nat Genet. 2001 Jun;28(2):139-45.
CF12 C. elegans rol-6(e187) II; lin-22(n372) IV; him-5(e1490) V. Show Description
Rollers. lin-22 and him-5 mutations affect neuroblast formation from epidermal precursor cell V5.
CF1295 C. elegans daf-16(mu86) I; daf-2(e1370) III; muEx108. Show Description
muEx108 [(pKL99-2) daf-16::GFP/daf16bKO + rol-6(su1006)]. Grows okay at 20C. Rollers should form dauers at 25C. Pick Rollers to maintain.
CF1380 C. elegans daf-16(mu86) I; daf-2(e1370) III; muEx158. Show Description
muEx158 [daf-16cAM::GFP + sur-5p::GFP] (AM = AKT-site mutant). Pick GFP+ worms to maintain. Sterile at 25C; grow at 20C or less. muEx158 contains GFP-tagged daf-16 c isoform (described as a1 isoform in Lin, et al. Nat Genet. 2001) with 4 Ser/Thr residues mutated to Ala, which completely rescues dauer formation and partially restores longevity of daf-16; daf-2 double mutants. Reference: Lin K, et al. Nat Genet. 2001 Jun;28(2):139-45.
CF1442 C. elegans daf-16(mu86) I; daf-2(e1370) III; muEx169. Show Description
muEx169 [unc-119p::GFP::daf-16 + rol-6(su1006)]. Pick Rollers to maintain. May grow better at 15C.
CF1449 C. elegans daf-16(mu86) I; daf-2(e1370) III; muEx176. Show Description
muEx176 [daf-16p::GFP::daf-16 + rol-6(su1006)]. Pick rollers to maintain -- Low transmission rate! Maintain at 15C. Forms dauers at 25C. Reference: Lin K, et al. Nat Genet. 2001 Jun;28(2):139-45.
CF1514 C. elegans daf-16(mu86) I; daf-2(e1370) III; muEx211. Show Description
muEx211[pNL213(ges-1p::GFP::daf-16) + rol-6(su1006)]. Grows at 15C (probably also at 20C). Pick Rollers to maintain.
CF1515 C. elegans daf-16(mu86) I; daf-2(e1370) III; muEx212. Show Description
muEx212[pNL212(myo-3p::GFP::daf-16) + rol-6(su1006)]. Grows at 15C (probably also at 20C). Pick Rollers to maintain.
CF1580 C. elegans daf-2(e1370) III; muIs84. Show Description
muIs84 [(pAD76) sod-3p::GFP + rol-6(su1006)]. Green expression in head, tail and around vulva. Daf-C at 25C. Grows well at 20C.
CF1588 C. elegans daf-16(mu86) I; daf-2(e1370) III; muIs84. Show Description
muIs84 [(pAD76) sod-3p::GFP + rol-6(su1006)]. Dim green expression in head, tail and around vulva. Daf-d. Can grow at 20C.
CF1595 C. elegans daf-16(mu86) I; daf-2(e1370) III; muEx227. Show Description
muEx227 [(pNL213) ges-1p::GFP::daf-16) + rol-6(su1006)]. Pick Rollers to maintain.
CF1660 C. elegans daf-16(mu86) I; daf-2(e1370) III; muIs84; muEx211. Show Description
muIs84 [(pAD76) sod-3p::GFP + rol-6(su1006)]. muEx211 [ges-1p::daf-16::GFP + rol-6(su1006)]. Pick Rollers to maintain. Partial rescue of lifespan phenotype. Some animals show variable daf-16 expression in the intestine. Grows okay at 15C. [NOTE: muEx211 is quite unstable. Be sure to pick Rollers to avoid losing the array.]
CF1724 C. elegans daf-16(mu86) I; daf-2(e1370) III; muIs105. Show Description
muIs105 [daf-16p::GFP::daf-16 + rol-6(su1006)]. Rollers; Rol phenotype is not always evident). Integrated line derived from CF1449. Maintain at 15C. Forms dauers at 25C. Reference: Lin K, et al. Nat Genet. 2001 Jun;28(2):139-45.
CF1814 C. elegans rrf-3(pk1426) II; daf-2(e1370) III. Show Description
Daf-c at 25.5C; grow at 20C or less. Long lived.
CF1827 C. elegans daf-16(mu86) I; daf-2(e1370) III; muEx268. Show Description
muEx268 [ges-1p::GFP::daf-16(cDNA) + odr-1::RFP]. daf-16 GFP expressed in intestine. Partial rescue of lifespan phenotype. Grows okay at 15C. Pick RFP to maintain.
CF1980 C. elegans rrf-3(pk1426) II; daf-2(e1368) III. Show Description
Daf-c at 25.5C; grow at 20C or less. Long lived.
CF2005 C. elegans daf-16(mu86) I; daf-2(e1370) III; muIs120. Show Description
muIs120 [ges-1p::GFP::daf-16 + rol-6(su1006)]. Maintain at 15-20C. Rollers. Long-lived. Gamma irradiation-induced integration of muEx211. Rescues daf-16a1/c in the intestine (described in Libina et al, 2003). Reference: Zhang P, et al. Cell Metab, 2013. 17(1): p. 85-100.
CF2031 C. elegans muEx306. Show Description
muEx306 [tcer-1::GFP + odr-1::RFP]. Maintain by picking RFP+ animals. Reference: Gahzi A, et al. PLoS Genet. 2009 Sep;5(9):e1000639.
CF2093 C. elegans daf-16(mu86) I; daf-2(e1370) III; muIs131. Show Description
muIs131 [unc-119p::GFP::daf-16 + rol-6(su1006)]. Maintain at 15-20C. Rollers. Modestly long-lived. Gamma irradiation-induced integration of muEx184. Rescues daf-16a1/c in neurons (described in Libina et al, 2003). Reference: Zhang P, et al. Cell Metab, 2013. 17(1): p. 85-100.
CF2102 C. elegans daf-16(mu86) I; daf-2(e1370) III; muIs126. Show Description
muIs126 [myo-3p::GFP::daf-16 + rol-6(su1006)]. Maintain at 15-20C. Rollers. Gamma irradiation-induced integration of muEx215. Rescues daf-16a1/c in muscles (described in Libina et al, 2003). Reference: Zhang P, et al. Cell Metab, 2013. 17(1): p. 85-100.
CF2154 C. elegans tcer-1(tm1452) II; glp-1(e2141) III. Show Description
Temperature sensitive sterile at 25C. tcer-1(-) causes loss of germ cells and increases lifespan. Reference: Ghazi A, Henis-Korenbilt S, & Kenyon C (2009) PLoS Genet 5(9):e1000639.
CF2167 C. elegans tcer-1(tm1452) II. Show Description
Temperature sensitive sterile at 25C. tcer-1(-) causes loss of germ cells and increases lifespan. Reference: Ghazi A, Henis-Korenbilt S, & Kenyon C (2009) PLoS Genet 5(9):e1000639.
CF2218 C. elegans ncl-1(e1942) III. Show Description
Abnormal large nucleoli in most cells.
CF237 C. elegans muIs2 unc-31(e169) IV. Show Description
muIs2 [mab-5::lacZ + unc-31(+)]. non-Unc.
CF250 C. elegans cat-4(e1141) him-5(e1490) V. Show Description
Catecholamine abnormal. Throws males.
CF2570 C. elegans daf-16(mu86) I; daf-2(e1370) III; muIs142. Show Description
muIs142 [ges-1p::GFP::daf-16(cDNA) + odr-1p::RFP]. Maintain at 15-20C. Gamma irradiation-induced integration of muEx268. Rescues daf-16a1/c in the intestine (described in Libina et al, 2003). Reference: Zhang P, et al. Cell Metab, 2013. 17(1): p. 85-100.
CF26 C. elegans lin-22(mu2) IV; him-5(e1490) V. Show Description
Alae-to-ray transformation similar to that of n372 animals.
CF301 C. elegans mab-5(e2088) III; unc-31(e169) IV; him-5(e1490) V; muIs9 X. Show Description
muIs9 [hs-mab-5 + C14G10]. Heat-shock inducible mab-5. C14G10 contains a WT copy of unc-31. muIs9 integrated by gamma irradiation.
CF31 C. elegans lin-22(mu5) IV; him-5(e1490) V. Show Description
Alae-to-ray transformation similar to that of n372 animals.
CF311 C. elegans mab-5(e1239) egl-5(n945) III; him-5(e1490) V. Show Description
CF3166 C. elegans muEx473. Show Description
muEx473 [kin-19p::kin-19::tagRFP + tph-1p::GFP]. Pick RFP+ GFP+ animals to maintain. Low transmission rate. Translational fusion of KIN-19 displaying age-dependent aggregation. Reference: David DC, et al. PLoS Biol. 2010 Aug 10;8(8):e1000450.
CF32 C. elegans lin-1(e1026) IV; him-5(e1490) V. Show Description
Very slow growth.
CF3556 C. elegans agIs6. Show Description
agIs6 [dod-24p::GFP]. Derived by outcrossing AU68 3 times to the Kenyon lab N2 strain. Reference: Yamawaki TM, et al. PLoS Biol. 2010 Aug 31;8(8). pii: e1000468.
CF3649 C. elegans muIs209. Show Description
muIs209 [myo-3p::kin-19::tagRFP + tph-1p::GFP]. KIN-19::tagRFP aggregates with age in body-wall muscles. Animals have reduced thrashing compared to controls. Generated in N2 background. References: Huang YC, et al. Elife. 2019 May 3;8. pii: e43059. doi: 10.7554/eLife.43059. David DC, et al. PLoS Biol. 2010 Aug 10;8(8):e1000450.
CF439 C. elegans lin-39(mu26) III; dpy-20(e1282) IV; him-5(e1490) V; muIs23. Show Description
muIs23 [hsp::lin-39 + (pMH86) dpy-20(+)]. Heat-shock inducible lin-39. muIs23 is a spontaneous integrant whose chromosomal location is unknown. [NOTE: This strain was previously described as carrying lin-39(n1760), but it is actually carrying the g to a substitution of mu26. Strain MT7255 has been confirmed to be carrying the a to t substitution of n1760.]
CF453 C. elegans muIs16 II; dpy-20(e1282) IV. Show Description
muIs16 [mab-5::GFP + dpy-20(+)]. non-Dpy.
CF491 C. elegans pry-1(mu38) I; him-5(e1490) V. Show Description
Very sick, Muv, Scrawny. Extra rays in males in body. Ectopic expression of lin-39, mab-5, egl-5. Cold sensitive - grows better at 25C.
CF579 C. elegans dpy-20(e1282) IV; him-5(e1490) V; muIs27. Show Description
muIs27 [mig-2::GFP + dpy-20(+)]. Him. non-Dpy. GFP is membrane enriched and expressed in many cells throughout development (see reference for details). Not known in which LG muIs27 is integrated.
CF65 C. elegans mab-5(e2088) III; lin-22(n372) IV; him-5(e1490) V. Show Description
mab-5 mutation affects ectodermal and mesodermal lineages. lin-22 and him-5 mutations affect neuroblast formation from the epidermal precursor cell V5.
CF693 C. elegans unc-31(e169) IV; him-5(e1490) V; muIs28. Show Description
muIs28 [mig-2::GFP + unc-31(+)]. muIs28 is not mapped, but probably on LG II by process of elimination.
CF716 C. elegans dpy-20(e1282) IV; mig-13(mu31) X; muIs37. Show Description
muIs37 [(pMS114) hsp::mig-13 + (pMH86) dpy-20(+)]. Inducible heat-shock promoter driven mig-13 rescues Q cell migration defects in mig-13(mu31) mutants. Reference: Sym, M., Robinson, N., and Kenyon, C. Cell. 1999 Jul 9;98(1):25-36.
CF80 C. elegans mab-3(mu15) II; him-5(e1490) V. Show Description
Abnormal V rays (male).
CF816 C. elegans him-5(e14??) V; ref-2(mu218) X. Show Description
In males, P7.p and P8.p fail to fuse with hyp7 at the end of L1. Dominant. him-5 allele is either e1467 or e1490.
CF891 C. elegans dpy-20(e1282) IV; muIs37. Show Description
muIs37 [(pMS114) hsp::mig-13 + (pMH86) dpy-20(+)]. Inducible heat-shock promoter driven mig-13 rescues Q cell migration defects in mig-13(mu31) mutants. Reference: Sym, M., Robinson, N., and Kenyon, C. Cell. 1999 Jul 9;98(1):25-36.