Search Strains

More Fields See WormTagDB for other published tagged loci.
Strain Species Genotype Add
ER10 C. elegans unc-123(jd5) III. Show Description
Temperature sensitive, semidominant mutant that is Unc when moving backward. Dorsal muscular contraction is stronger than that of ventral, resulting in an asymmetric pattern of locomotion in which the animal either forms a dorsal coil or moves in circles with the dorsal side central to the circle. Most likely a gain of function allele of sup-1.
ERT691 C. elegans rcs-1(jy84) X. Show Description
Full CRISPR deletion of rcs-1 via CRISPR in a dpy-10 background, outcrossed 3x to wild-type. Superficially wild-type. Reference: Panek J, et al. Proc Natl Acad Sci USA. .2020 Apr 7;117(14):7950-7960. doi: 10.1073/pnas.1918417117. PMID: 32193347.
ERT848 C. elegans fbxa-75(jy143) III. Show Description
Full CRISPR deletion of fbxa-75 via CRISPR in a dpy-10 background, outcrossed 3x to wild-type. Superficially wild-type. Reference: Panek J, et al. Proc Natl Acad Sci USA. .2020 Apr 7;117(14):7950-7960. doi: 10.1073/pnas.1918417117. PMID: 32193347.
ERT852 C. elegans fbxa-158(jy145) II. Show Description
Full CRISPR deletion of fbxa-158 via CRISPR in a dpy-10 background, outcrossed 3x to wild-type. Superficially wild-type. Reference: Panek J, et al. Proc Natl Acad Sci USA. .2020 Apr 7;117(14):7950-7960. doi: 10.1073/pnas.1918417117. PMID: 32193347.
ET100 C. elegans H01G02.2(ok200) IV. Show Description
H01G02.2. External left primer: TGCATCCCTTTGATTCCTTC. External right primer: AAACCTGGGCGCTTTTATTT. Internal left primer: GCAATCCTTGCTTGATCCAT. Internal right primer: TGATTGCAACGTTCCATGAT. Internal WT amplicon: 3033 bp. Deletion size: 1251 bp. Deletion left flank: AAACTCACTTTTGAAACATTCGGGACCATT. Deletion right flank: GATGAAGATCATGGAACGTTGCAATCAATT. This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. URL: http://www.celeganskoconsortium.omrf.org.
ET137 C. elegans C30G12.1(ok910) II. Show Description
C30G12.1 Homozygous. No overt morphological or behavioral abnormalities. 1286 bp deletion. The region of cosmid C30G12 that is deleted is 39,238 - 40,523 bps (inclusive). The deletion includes an ectopic 5 bp sequence, GGTTA. The sequence crossing the deletion for ok910 is: ....GCCATGGTTAAAAGT GGTTA AAAAATTCAGTATAT... This deletion was generated by the C. elegans Gene Knockout Project at OMRF, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publication resulting from its use. http://www.mutantfactory.ouhsc.edu/
ET507 C. elegans daf-16(mu86) I; cki-2(ok2105) II; glp-1(ar202) III. Show Description
Temperature-sensitive. Maintain at 15C. Animals form germline tumors that prevent fertility at restrictive temerature (25C). This is the first strain reported to be used for the isolation of germ cells for in vitro culture. This strain allows germ cells to remain viable for longer periods than other tumorous mutant strains tested. Reference: Chaudhari SH, et al. Dev Cell. 2016 Jul 11;38(1):33-46.
EU1006 C. elegans dnc-1(or404) IV. Show Description
Temperature sensitive. At 15C, 100% viable. At 26C, 2% viable. At 25C, 10% viable. Missense mutation R to C at position 1237 (nucleotide #3709: cgt to tgt). Reduced brood size after upshift. Received new stock 12/04.
EU1008 C. elegans apo-5(or358) I. Show Description
Temperature sensitive, embryonic lethal mutant. 98% of embryos produced by homoygous mothers hatch at 15C; 0% produced at 26C hatch (but some viability at 25C). Mutation is recessive at 26C. First mitotic spindle in one-cell zygote is mis-positioned, often abnormally near the posterior pole; some chromosome segregation defects.
EU1068 C. elegans unc-119(ed3) ruIs32 III; repo-1 (or430) IV; ruIs57. Show Description
ruIs32 [pie-1p::GFP::H2B + unc-119(+)] III. ruIs57 [pie-1p::GFP::tubulin + unc-119(+)]. Maintain at 15C. Temperature-sensitive embryonic-lethal at restrictive temperature of 26C; viable at permissive temperature of 15C. Reversed AP polarity axis at restrictive temperature with his-11::GFP and tubulin::GFP expression. Reference: Keikhaee MR, et al. PLoS One. 2014 Sep 4;9(9):e106484.
EU1073 C. elegans him-8(e1489) IV; act-2(or295) V. Show Description
Weakly semi-dominant, temperature sensitive, embryonic lethal mutant. 38% of embyros produced by homozygous mothers at 15C will hatch; 2% produced at 26C will hatch. Mutation is semi-dominant at 26C: 12% of embryos produced by heterozygous mothers hatched at 26C, and about 25% of the survivors were or295/or295, indicating the lethality is semi-dominant and maternal. Mutant embyros exhibit excess cortical actomyosin contractility (extra furrows and protrusions) in early embryonic cells, during interphase and most of mitosis. Throws males. or295 is a gga to aga substitution (G16R).
EU1074 C. elegans gpr-1(or574) III. Show Description
Temperature-sensitive embryonic-lethal mutant. Maintain at 15C. Embryonic lethal at restrictive temperature of 26C; viable embryos at permissive temperature of 15C. [NOTE: PCR detection of or574 can be difficult. gpr-1 and gpr-2 paralogues are closely linked and 97% identical in DNA sequence.] Reference: Couwenbergs C, et al. J Cell Biol. 2007 Oct 8;179(1):15-22.
EU1133 C. elegans apo-5(or358) ruIs32 III Show Description
ruIs32 [pie-1p::GFP::H2B + unc-119(+)] III. apo-5(or358) is temperature-sensitive embryonic lethal. 100% dead embryos when L4 larvae are shifted to 26.6C. A small percentage of embryos survive form L4 larvae shifted to 25-26C. or358 appears to be semi-dominant; L4 or358/+ heterozygotes shifted to 26C produce ~20% embryonic lethality. Maintain at 15C. References: Encalada SE, et al., Mol Biol Cell. 2005 Mar;16(3):1056-70. Strome S, et al. Mol Biol Cell. 2001 Jun;12(6):1751-64.
EU1381 C. elegans act-2(or295) V. Show Description
Weakly semi-dominant, temperature sensitive, embryonic lethal mutant. 38% of embyros produced by homozygous mothers at 15C will hatch; 2% produced at 26C will hatch. Mutation is semi-dominant at 26C: 12% of embryos produced by heterozygous mothers hatched at 26C, and about 25% of the survivors were or295/or295, indicating the lethality is semi-dominant and maternal. Mutant embyros exhibit excess cortical actomyosin contractility (extra furrows and protrusions) in early embryonic cells, during interphase and most of mitosis. or295 is a gga to aga substitution (G16R).
EU1383 C. elegans act-2(ok1229) V. Show Description
Strain is homozygous viable due to redundancy of act- and act-3 genes. AT 15C, all embyros produced by homozygous mothers hatch; at 26C, 88% of embryos hatch. Deletion which removes 544 nucleotides of act-2 plus the predicted 3' UTR and 705 nucleotides 3' of that. This removes 163/376 amino acids of the act-2 sequence (calculated with ATG methionine included). Sequence of deletion is (text inside of slashes is deleted, with 5' and 3' sequences shown): (exon#2)5'....gtgaaatcgtgcgtgacatc/aaggagaagctttgtt........ ...tggatagacattggtgt/gcgcactccttctggat.....3'(872 nucleotides from stop codon). Removes 489/1131 coding base pairs, beginning in second exon and extending beyond the 3' UTR.
EU1472 C. elegans let-99(or204) IV; him-5(e1490) V. Show Description
let-99(or204) is temperature-sensitive, maternal-effect, embryonic-lethal. Nearly completely penetrance of lethality at 26C. Viable at 15C. Maintain at 15C. Reference: Goulding MB, et al. J Cell Biol. 2007 Sep 24;178(7):1177-91.
EU1485 C. elegans ltIs37 IV; orIs13. Show Description
ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. orIs13 [pie-1p::GFP::npp-22(genomic)::pie-1 3'UTR + unc-119(+)]. GFP-tagged NPP-22. Superficially wild-type. Might still carry unc-119(ed3) in background. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.] Reference: O'Rourke SM, et al. PLoS Genet. 2007 Aug;3(8):e128.
EU1510 C. elegans zyg-9(or634) II. Show Description
Temperature sensitive. Maintain at 15C. At 26C, animals give rise to 100% dead embryos, with embryos exhibiting lack of pronuclear migration at the one-cell stage. At 15C, animals give rise to viable progeny.
EU1600 C. elegans aspm-1(or645); ltIs37 IV; ojIs1. Show Description
ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. ojIs1 [pie-1p::GFP::tbb-2 + unc-119(+)]. Temperature-sensitive. Viable at 15C. Complete loss of aspm-1 function at 26C. Shift to restrictive temperature for 3-6 hours to induce oocyte meiotic spindle phenotype and bypass sterility. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.] Reference: Connolly A, et al. Mol Biol Cell. 2014 Apr;25(8):1298-311. PMID: 24554763
EU2470 C. elegans unc-119(ed3) III; orEx25. Show Description
orEx25 [GFP::aspm-1 + unc-119(+)]. Maintain at 25C. Pick non-Unc GFP+ to maintain. GFP might not be visible at low magnification. Reference: Connolly AA, et al. Mol Biol Cell. 2014 Apr;25(8):1298-311.
EU2695 C. elegans klp-7(or1292) III; ltIs37 IV; ojIs1. Show Description
ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. ojIs1 [pie-1p::GFP::tbb-2 + unc-119(+)]. Temperature-sensitive embryonic lethal. Maintain at 15C. Shift to 25-26C for 2-6 hours to induce meiotic spindle phenotype. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.] Reference: Connolly AA, et al. J Cell Biol. 2015 Sep 14;210(6):917-32. PMID: 26370499
EU2697 C. elegans mei-1(or1178) I; ItIs37 IV; ojIs1. Show Description
ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. ojIs1 [pie-1p::GFP::tbb-2 + unc-119(+)]. Maintain at 15C; sterile at 26C. Shift to restrictive temperature (26C) for 3-6 hours to induce oocyte meiotic spindle phenotype and bypass sterility. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.] Reference: Connolly A, et. al. Mol Biol Cell. 2014 Apr;25(8):1298-311.
EU2715 C. elegans klp-7(or1092) III; ltIs37 IV; ojIs1. Show Description
ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. ojIs1 [pie-1p::GFP::tbb-2 + unc-119(+)]. Temperature-sensitive embryonic lethal. Maintain at 15C. Shift to 25-26C for 2-6 hours to induce meiotic spindle phenotype. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.] Reference: Connolly AA, et al. J Cell Biol. 2015 Sep 14;210(6):917-32. PMID: 26370499
EU2858 C. elegans repo-1(or430) IV; itIs153; ojIs1. Show Description
itIs153 [pie-1p::par-2::GFP + rol-6(su1006) + N2 genomic DNA]. ojIs1 [pie-1p::GFP::tbb-2 + unc-119(+)]. Maintain at 15C. Temperature-sensitive embryonic-lethal at restrictive temperature of 26C; viable at permissive temperature of 15C. Reversed AP polarity axis at restrictive temperature with par-2::GFP and tubulin::GFP expression. itIs153 is an integrated derivitive of axEx1094. Reference: Keikhaee MR, et al. PLoS One. 2014 Sep 4;9(9):e106484.
EU2866 C. elegans ltIs37 IV; orIs1. Show Description
ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. orIs1 [pie-1p::GFP::mei-1 + unc-119(+)]. Maintain at 25C to retain transgene fluorescence. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.] Reference: Connolly AA, et al. J Cell Biol. 2015 Sep 14;210(6):917-32. PMID: 26370499
EU2876 C. elegans aspm-1(or1935[GFP::aspm-1]) I; ltIs37 IV. Show Description
ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. GFP::aspm-1 localizes to meiotic spindle poles and centrosomes during early development. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.] Reference: Connolly AA, et al. J Cell Biol. 2015 Sep 14;210(6):917-32. PMID: 26370499
EU3000 C. elegans sas-7(or1940[gfp::sas-7]) III; ltIs37 IV. Show Description
sas-7(or1940[gfp::sas-7]) III. ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. Green centriole signal and red chromosome signal. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.] Reference: Sugioka, et al., 2017 Elife 6 e20353.
EU3030 C elegans ijmSi3 I; unc-119(ed3) III; ltIs37 IV. Show Description
ijmSi3 [mex-5p::cls-2(re-encoded)::GFP::tbb-2 3'UTR + Cbr-unc-119(+)] I. ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. The coding sequence of GFP-tagged cls-2 in the transgene was re-coded using silent mutations to render it insensitive to RNAi-depletion of endogenous cls-2 expression. mCherry expression marks histones. Not known if unc-119(ed3) is still carried in the background of this strain. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.] Reference: Schlientz A and Bowerman B. PLoS Genet. 2020 Oct 7;16(10):e1008751. doi: 10.1371/journal.pgen.1008751.
EU3095 C elegans aspm-1(or1935[GFP::aspm-1]) I; zyg-9(or1984) II; ltIs37 IV. Show Description
ItIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. Maintain at 15C. Fast-acting temperature-sensitive allele. At restrictive temperature (26C), animals give rise to 100% dead embryos. At 15C, animals give rise to viable progeny. GFP::aspm-1 localizes to meiotic spindle poles and centrosomes during early development. Might still carry unc-119(ed3) III in background. Reference: Harvey AM, et al. PLoS Genet. 2023 Jan 6;19(1):e1010363. doi: 10.1371/journal.pgen.1010363. PMID: 36608115
EU3115 C elegans klp-15(ok1958) klp-16(or1952)/tmC18[dpy-5(tmIs1236)] I; ltIs37 IV; ruIs57. Show Description
ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. ruIs57 [pie-1p::GFP::tubulin + unc-119(+)]. tmC18 balancer marked with myo-2p::mCherry and Dpy. Heterozygotes are wild-type with pharyngeal mCherry, and segregate mCherry+ heterozygotes, tmC18 homozygotes (mCherry+ Dpy) and non-mCherry klp-15/16 homozygotes. Homozygous double deletion mutants are fertile but produced reduced brood sizes with highly penetrant embryonic lethality; will also segregate some males. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.] Reference: Chuang CH, et al., Biology Open 2020 9: bio052308 doi: 10.1242/bio.052308 Published 25 June 2020
EU3121 C. elegans tac-1(or1955[gfp::tac-1]) II; ltIs37 IV. Show Description
ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. GFP tag inserted into endogenous tac-1 locus. Might still contain unc-119(ed3) in the background. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.] Reference: Chuang CH, et al., Biology Open 2020 9: bio052308 doi: 10.1242/bio.052308 Published 25 June 2020
EU3169 C. elegans zyg-9(or1956[gfp::zyg-9]) II; ltIs37 IV. Show Description
ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. GFP tag inserted into endogenous zyg-9 locus. Might still contain unc-119(ed3) in the background. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.] Reference: Chuang CH, et al., Biology Open 2020 9: bio052308 doi: 10.1242/bio.052308 Published 25 June 2020
EU3201 C elegans klp-15(ok1958) aspm-1(syb1260[gfp::aspm-1]) klp-16(or1952) /tmC18[dpy-5(tmIs1236)] I; ltIs37[pie-1p::mCherry::H2B::pie-1 3'UTR + unc-119(+)] IV Show Description
ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. ruIs57 [pie-1p::GFP::tubulin + unc-119(+)]. GFP tag inserted into endogenous aspm-1 locus. tmC18 balancer marked with myo-2p::mCherry and Dpy. Heterozygotes are wild-type with pharyngeal mCherry, and segregate mCherry+ heterozygotes, tmC18 homozygotes (mCherry+ Dpy) and non-mCherry triple mutant homozygotes. Homozygous triple mutants are fertile but produced reduced brood sizes with highly penetrant embryonic lethality; will also segregate some males. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.] Reference: Chuang CH, et al., Biology Open 2020 9: bio052308 doi: 10.1242/bio.052308 Published 25 June 2020
EU3407 C elegans zyg-9(or1985)/mnC1[dpy-10(e128) unc-52(e444) umnIs32] II. Show Description
umnIs32 [myo-2p::GFP + NeoR, II: 11755713 (intergenic)] II. or1985 is a CRISPR/Cas9 engineered deletion of zyg-9 removing the entire open reading frame. Heterozygotes are wild-type and GFP+ and segregate WT GFP+ (hets), or1948 homozygotes (GFP-, lay 100% dead embryos) and paralysed DpyUnc GFP+ (mnC1 homozygotes). Maintain by picking WT GFP+. Reference: Harvey AM, et al. PLoS Genet. 2023 Jan 6;19(1):e1010363. doi: 10.1371/journal.pgen.1010363. PMID: 36608115
EU3501 C elegans apx-1(or2015) V/nT1 [unc-?(n754) let-?] (IV;V). Show Description
Heterozygous. Pick Unc to maintain. Heterozygotes are Unc and segregate Unc heterozygotes, wildtype (or2015 homozygotes that give only dead progeny), and and arrested nT1 aneuploids. Pick Unc and check for correct segregation of progeny to maintain. or2015 is a CRISPR/Cas9-engineered null allele removing the entire apx-1 open reading frame. Reference: Chuang CH, et al. G3 (Bethesda). 2025 Sep 26:jkaf229. doi: 10.1093/g3journal/jkaf229. PMID: 41004705.
EU365 C. elegans mom-2(or85) V/nT1 [unc-?(n754) let-?] (IV;V). Show Description
mom-2(or85) is a recessive, non-conditional maternal-effect embryonic lethal. Strong allele; missense mutation near N-terminus: L77P. 85% of mutant embryos lack gut. Heterozygotes are Unc. [NOTE: (08-27-2014) We have been informed that the mutation carried in this strain is the same molecular lesion as or77. We are working to determine if or85 and or77 are in fact the same lesion or if an incorrect genotype was provided for the strain.]
EU588 C. elegans him-8(e1489) IV; spn-4(or191) V. Show Description
Temperature sensitive. Viable at 15C; lethal at 25C. At 25C, embryos exhibit defects in spindle orientation and cell fate patterning. Throws males.
EU716 C. elegans zen-4(or153) IV. Show Description
Temperature-sensitive, embryonic-lethal mutant that lacks a central spindle during early embryonic mitosis and exhibits a late cytokinesis defect (cleavage furrows regress after ingressing in nearly to the center of dividing embryonic cells). About 100% of embryos produced by homozygous mothers hatch at 15C; 0% hatch at 26C. ZEN-4 = vertebrate MKLP1 kinesin. There are two mis-sense mutations present in zen-4(or153). One is a D520N (GAC to AAC) and the other is D735N (GAT to AAT). Whether one or both is responsible for the phenotype is not know. Maintain at 15C. Shift L4s to 26 overnight to observe mutant phenotype on embyros produced by adults.
EU828 C. elegans dhc-1(or195) I. Show Description
Homozygous or195 hermaphrodites make 100% dead embryos at 26C. One-cell embryo has a very small but bipolar spindle, severe chromosome segregation defect. Maintain at 15C. Previously called spd-4. 2/06: From Bruce Bowerman: The or195 mutation changes base 10,679 of the cosmid clone T21E12 from a C to a T. This corresponds to dhc-1 cDNA nucleotide 9599 (WS153) , which is the center nucleotide of codon 3200. This codon changes from Serine in N2 to Leucine in or195 (S3200L). Note: this is not the same mutation for or195ts that we reported in Hamill et al, 2002(Dev Cell 3, 673-684). The mutation reported in our paper is not present in this strain. We apologize for the confusion. The pairs dhc-11a,b amplify the mutated fragment in dhc-1(or195). The mutation is near the center of this fragment; a clean (gel purified) DNA prep helps get a good read of it. dhc-11b: 5' aacagacgcacgattgacct 3'. dhc-11a: 5' ctcaaatcaaggaaggagct 3'. PCR conditions: 5 min at 94 degrees C; 30 sec at 94 degrees C; 30 sec at 55 degrees C; 1 min at 72 degrees C. 35 Cycles using Taq polymerase.
EU923 C. elegans spn-4(or191) V. Show Description
Temperature sensitive. Viable at 15C; lethal at 25C. At 25C, embryos exhibit defects in spindle orientation and cell fate patterning.
EU931 C. elegans zyg-8(or490) III; lin-2(e1309) X. Show Description
Maintain at 15C. Temperature-sensitive embryonic-lethal at restrictive temperature of 26C. Viable embryos at permissive temperature of 15C. Mitotic spindle in one-cell stage embryo assembles normally, but microtubules destabilize at anaphase and spindle becomes mis-positioned toward the posterior pole leading to highly abnormal cleavage and chromosome segregation defects. References: Gonczy P, et al. Dev Cell. 2001 Sep;1(3):363-75. Bellanger JM, et al. J Cell Sci. 2007 Aug 15;120(Pt 16):2963-73.
EU944 C. elegans tac-1(or455) II. Show Description
Homozygous mutant animals give rise to >99% dead embyros at the restrictive temperature of 26C, with embryos exhibiting a lack of pronuclear migration at the one-cell stage. Homozygous mutant animals give rise to viable progeny at the permissive temperature of 15C. Maintain at 15C.
EV190 C. elegans gld-4(ef15) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Homozygous nearly sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ef15 homozygotes (pale, nearly sterile, lays few eggs). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Reference: Schmid M, et al. Genes Dev. 2009 Apr 1;23(7):824-36.
EV57 C. elegans gls-1(ef8) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Homozygous nearly sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ef8 homozygotes (nearly sterile, lays few eggs). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Reference: Rybarska A, et al. PLoS Genet. 2009 May;5(5):e1000494.
EW15 C. elegans bar-1(ga80) X. Show Description
[NOTE: (10/22/2020) This strain also carries a (T to A) missense mutation in pry-1 which results in a PRY-1 N354K amino acid substitution.] bar-1(ga80) hermaphrodites are usually Egl and often have a protruding vulva (Pvl), although approx. 40% of animals appear WT on plates. Also slightly Unc. In bar-1(ga80) hermaphrodites any of the six vulval precursor cells (P3.p - P8.p) can sometimes fuse with hyp7 without dividing, and P5.p - P7.p can adopt the tertiary cell fate instead of the primary or secondary fates. In addition, the neuroblast QL and its progeny migrate towards the anterior instead of the posterior, and the cell P12 usually adopts the fate of P11. bar-1(ga80) do mate, but poorly. bar-1 encodes a beta-catenin molecule and the ga80 mutation is predicted to cause an early truncation of the protein.
FC121 C. elegans zzIs16. Show Description
zzIs16 [(pJE3) eff-1p::GFP + rol-6(su1006)]. GFP+ Rollers. Chromosomal insertion of zzEx10. Integration site of zzIs16 not yet mapped, but it is not tightly linked to eff-1 II, unc-119 III, or jcIs1 IV. pJE3 has 7.5 kb of eff-1 upstream sequence inserted into pPD95.75, driving cytoplasmic GFP expression.
FF41 C. elegans unc-116(e2310) III. Show Description
Hypomorphic allele. Fully viable and fertile. Strongly uncoordinated larvae, tend to coil backward. Dpyish, mildly Unc adults. Isolated out of a mutator strain also containing uncharacterized e2281 and e2282.
FF628 C. elegans let-756(s2613) unc-32(e189) III. Show Description
Homozygous viable and fertile, but slow growing, transparent and small. Originally from BC4253 but outcrossed an additional 7 times.
FGP30 C. elegans gei-17(fgp1[GFP::FLAG::degron::loxP::gei-17]) I; ltIs37 IV. Show Description
gei-17(fgp1[GFP::FLAG::degron::loxP::gei-17]) I. ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.] Reference: Pelisch et al. Mol Cell. 2017 Jan 5;65(1):66-77.
FK163 C. elegans cam-1(ks52) II. Show Description
Deletion of the tyrosine kinase domain of kin-8. Partial Daf-c especially on an old lawn of E. coli. Reduced daf-7 expression in ASI. Dye-filling defective in ASI. Abnormal ASI cell position. 10-20% of animals show withered (Wit) tail phenotype or defects in elongation or migration of posterior gonad. Previously called kin-8.