Search Strains

Caenorhabditis elegans wild isolate. Isolated from compost from Jenny Pettifor's garden in the Paview neighborhood in Johannesburg, South Africa, on May 5, 2006. Haplotype (according to Cutter 2006 and Dolgin et al 2008): alpha. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).

Caenorhabditis elegans wild isolate. Isolated from compost at a plant nursery at the Ceres Fruit Farms in the Western Cape province near Ceres, South Africa, on May 5, 2006. Haplotype (according to Cutter 2006 and Dolgin et al 2008): beta. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).

Caenorhabditis elegans wild isolate. Isolated from compost at a plant nursery at the Ceres Fruit Farms in the Western Cape province near Ceres, South Africa, on May 5, 2006. Haplotype (according to Cutter 2006 and Dolgin et al 2008): gamma. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).

Caenorhabditis elegans wild isolate. Isolated from compost at a plant nursery at the Ceres Fruit Farms in the Western Cape province near Ceres, South Africa, on May 5, 2006. Haplotype (according to Cutter 2006 and Dolgin et al 2008): delta. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).

Caenorhabditis briggsae wild isolate. Isolated from compost from Jenny Pettifor's garden in the Paview neighborhood in Johannesburg, South Africa, on May 5, 2006. Landscape: Urban_garden. Isolated from a compost sample from a private garden in Johannesburg, South Africa, March-April 06 by E. Dolgin. Same compost sample as ED3078-3089. WBPaper00035666. GPS: -26.200001 28.000000, Johannesburg, South Africa. Substrate: compost_heap. Sampled_by: Elie Dolgin WBPerson12345. 2006. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).

mudIs1 [tph-1p::ChR2::GFP + myo-3p::mCherry]. Worms stop moving when exposed to blue light. Reference: Pokala N & Glater EE. 2018. Journal of Undergraduate Neuroscience Education. 162(2): A152-A158.

mudIs1 [tph-1p::ChR2::GFP + myo-3p::mCherry]. Worms stop moving when exposed to blue light. Reference: Pokala N & Glater EE. 2018. Journal of Undergraduate Neuroscience Education. 162(2): A152-A158.

T04D1.3 Homozygous. Outer left primer sequence: GCGAATCAATACCTTTCGGA. Inner left primer sequence: GCTACTCGAGCAAAAATGGC. Outer right primer sequence: CCTGGTGGAGGTCCTTGATA. Inner right primer sequence: TCAAGGGTATCGCTTTTTCG. Deletion length: 1959 bp. Deletion breakpoints: AAGCTGTCAAAGTTTAATTTTTTTTTAATCTGCTGAAATTTTTTTCCACTTCCCCTTTT AGATATAATCACAAAAAAATTCTTTT[left break]....deletion....[right break]GAATTTTTTAAATCAATTTTCTAAATCGAAACTATTCGTTTTTCAATTTTTAT TTTAAAAAATCGAAAAAGCGATACCCTTGATTA. This strain was provided by the C. elegans Gene Knockout Project at OMRF, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. http://www.mutantfactory.ouhsc.edu

Isolated by Michael Ailion from rotting apricot from home of Wayne Davis and Danielle Endres in Salt Lake City, Utah, 8/4/2006, under tree on north side of house. Coordinates: 40° 42' 26.16" N, 111° 52' 3.27" W. Animals move very rapidly. Strain started from a single L4 hermaphrodite and grown three generations before freezing. 18S rDNA sequence differs from C. briggsae NCBI entry (PB102), but is identical to the 18S sequence of AF16, HK104, PB800 and VT847. Cross-fertile with AF16. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).

Unc. Not caused by ttTi5605. Mos1 allele generated by NemaGENETAG consortium (Laurent Segalat). [NOTE: 11/15/11 - This strain contains unc-119(ed9), not unc-119(ed3) as previously reported. (C. Frokjaer-Jensen)] [NOTE: The Dernburg lab has noticed an increased number of rad-51 foci in EG4322 compared to N2. Please use the outcrossed version of this strain (EG6699) instead, which does not have this problem. (C. Frokjaer-Jensen)]

oxIs253 [unc-122p::GFP + unc-119(+)]. Wild type. Very dim GFP expression in the coelomycytes. Only visible on compound microscope. Plasmid pCFJ68 inserted by MosSCI into ttTi5605 site.

oxIs279 [pie-1p::GFP::H2B + unc-119(+)]. Wild type. Persistent GFP expression in germline. Visible on dissection microscope. Plasmid pCFJ127 inserted by MosSCI into ttTi5605 site.

Male-female strain. Maintain by mating. Caenorhabditis sp. 6 wild isolate. Isolated by Michael Ailion and Ana-Joao Rodrigues from a rotting apple collected from the home of Anabela Fernandes in Amares, Portugal (address: Dr. Adolofo Vilela, no. 29, 4720-019 Amares, Portugal). Coordinates: 41 degrees, 37', 43.577 " N; 8 degrees, 20', 51.421 " W. Apple collected March 28, 2007. The apple produced a number of growing animals in different stages, including adults of both sexes. Male/Female Caenorhabditis species. 18S RNA sequence places it closest to PS1010 C. sp. 3.

oxIs318 [spe-11p::mCherry::histone + unc-119(+)]. Wild type. Dim mCherry expression in hermaphrodite sperm. Barely visible on bright dissection microscope; visible on compound microscope. Plasmid pCFJ167 inserted by MosSCI into ttTi5605 site.

oxIs322 [myo-2p::mCherry::H2B + myo-3p::mCherry::H2B + Cbr-unc-119(+)]. Wild type worms with mCherry fluorescence in pharyngeal and body wall muscle. Visible on dissection microscope at high magnification. Complex transgene insertion in place of Mos1 allele ttTi5605. Useful for following "invisible" insertions at ttTi5605 site by Mos1 Single Copy gene Insertion (MosSCI). Please note: The insertion was a complex event pulling in more than one transgene and parts of the array. Therefore, the exact molecular structure of the insert is not known. Therefore the strain should NOT be used as a control for insert copy number or other detailed molecular controls of MosSCI insertions. Succesfully used as a balancer for the ttTi5605 locus.

oxIs363 [unc-122p::GFP + unc-119(+)]. Wild type. Very dim GFP expression in the coelomycytes. Only visible on compound microscope. Plasmid pBN04 inserted by MosSCI into cxTi10882 site.

Caenorhabditis sp. 9 Male-female strain. Isolated from a sample collected by Joel Ehrenkranz on May 20, 2008, around 11 AM in Shinkolobwe, Katanga Province, Democratic Republic of the Congo (~11°S, 26°E). The sample was collected from worked soil which contained organic material around the foundation of a wattle hut. This time of year was the dry season in Katanga Province, so daytime temperatures were in the high 70s and nighttime temperatures in the low 50s. The specimen was placed in a ziplock bag with a slice of apple for transport to Susan Mango's lab at the Huntsman Cancer Institute, Salt Lake City, Utah. From the date of collection until the specimen reached the lab was approximately 2 weeks.

Caenorhabditis sp. 14 Male-female strain. Isolated from a rotten horse chestnut (Tahitian chestnut?) collected by David Ailion on the island of Moorea (17.53 S, 149.83 W) on July 24, 2009.

oxSi221 [eft-3p::GFP + Cbr-unc-119(+)] II. Broad, bright GFP fluorescence clearly visible on dissection scope. Single copy insert into MosSCI site ttTi5605 on Chr. II. Can be used as balancer.

oxSi230 [eft-3p::GFP + Cbr-unc-119(+)] X. Broad, bright GFP fluorescence. Clearly visible on dissection scope. Single copy insert into MosSCI site ttTi14024 on Chr. X. Can be used as balancer.

oxSi257 [eft-3p::GFP + Cbr-unc-119(+)] I. Broad, bright GFP fluorescence. Clearly visible on dissection scope. Single copy insert into MosSCI site ttTi4391 on Chr. I. Can be used as balancer.

oxSi259 [eft-3p::GFP + Cbr-unc-119(+)] I. Broad, bright GFP fluorescence. Clearly visible on dissection scope. Single copy insert into MosSCI site ttTi4348 on Chr. I. Can be used as balancer.

oxSi346 [eft-3p::GFP + Cbr-unc-119(+)] IV. Broad, bright GFP fluorescence. Clearly visible on dissection scope. Single copy insert into MosSCI site cxTi10816 on Chr. IV. Can be used as balancer.

oxIs565 [dpy-30p::frt::mCherry::frt::GFP::H2B + Cbr-unc-119(+)] II. Ubiquitous mCherry expression. Green nuclei after FLP activity. Integration into ttTi5605 mosSCI site (II:0.77). oxTi80 [eft-3p::GFP::H2B::tbb-2 3'UTR + unc-18(+)] III. Nuclear, green fluorescence is broadly expressed (in most cells). Integration into chr. III: 21.21. oxSi199 [unc-57p::tdTomato + unc-119(+)] IV. Synaptic red fluorescence visible on fluorescence dissecting scope. Integration into cxTi10882 mosSCI site (IV:-0.05). Combined fluorescent balancer strain for LG II, LG III and LG IV.

oxEx1582 [eft-3p::GFP + Cbr-unc-119(+)]. Pick non-Unc to maintain. Pick Unc to use for injection. oxEx1582 array is stable; pick individual animals to obtain Uncs rather than maintaining by chunking.

oxIs322 [myo-2p::mCherry::H2B + myo-3p::mCherry::H2B + ? + Cbr-unc-119(+)] III. Nuclear, red fluorescence in pharynx and body wall muscle. Complex integration into ttTi5605 mosSCI site (II:0.77). oxSi199 [unc-57p::tdTomato + unc-119(+)] IV. Synaptic red fluorescence visible on fluorescence dissecting scope. Integration into cxTi10882 mosSCI site (IV:-0.05). oxTi81 [eft-3p::GFP::H2B::tbb-2 3'UTR + unc-18(+)] V. Nuclear, green fluorescence is broadly expressed (in most cells). Integration into chr.V: 1.21. Him. Combined fluorescent balancer strain for LG II, LG IV and LG V. Strain contains him-5(e1490) to generate males for crosses.

oxIs322 [myo-2p::mCherry::H2B + myo-3p::mCherry::H2B + ? + Cbr-unc-119(+)] III. Nuclear, red fluorescence in pharynx and body wall muscle. Complex integration into ttTi5605 mosSCI site (II:0.77). oxTi80 [eft-3p::GFP::H2B::tbb-2 3'UTR + unc-18(+)] III. Nuclear, green fluorescence is broadly expressed (in most cells). Integration into chr. III: 21.21. oxSi199 [unc-57p::tdTomato + unc-119(+)] IV. Synaptic red fluorescence visible on fluorescence dissecting scope. Integration into cxTi10882 mosSCI site (IV:-0.05). Him. Combined fluorescent balancer strain for LG II, LG III and LG IV. Strain contains him-5(e1490) to generate males for crosses.

oxSi255 [snt-1p::GFP + Cbr-unc-119(+)] I. Integration into ttTi4348 mosSCI site (I:-5.32). Pan-neuronal GFP expression visible under dissection microscope. oxIs322 [myo-2p::mCherry::H2B + myo-3p::mCherry::H2B + ? + Cbr-unc-119(+)] III. Nuclear, red fluorescence in pharynx and body wall muscle. Complex integration into ttTi5605 mosSCI site (II:0.77). oxSi199 [unc-57p::tdTomato + unc-119(+)] IV. Synaptic red fluorescence visible on fluorescence dissecting scope. Integration into cxTi10882 mosSCI site (IV:-0.05). Him. Combined fluorescent balancer strain for LG I, LG II and LG IV. Strain contains him-5(e1490) to generate males for crosses.

oxTi872 [vha-6p::GFP::tbb-2 3'UTR + Cbr-unc-119(+)] III. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Cytoplasmic green fluorescence in intestinal cells visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (III:-1.41). Insertion into C23G10.7 3'UTR. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1401 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection.

oxTi873 [vha-6p::GFP::tbb-2 3'UTR + Cbr-unc-119(+)] IV. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Cytoplasmic green fluorescence in intestinal cells visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (IV:6.44). Insertion into ZK896.1. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1401 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection.

oxTi874 [vha-6p::GFP::tbb-2 3'UTR + Cbr-unc-119(+)] V. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Cytoplasmic green fluorescence in intestinal cells visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (V:-13.00). Insertion into srh-36. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1401 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection.

oxTi875 [vha-6p::GFP::tbb-2 3'UTR + Cbr-unc-119(+)] V. Strain is healthy. NOTE: High percentage of males observed (unpublished observations, Chee Kiang Ewe, Rothman lab, UCSB). NOTE: This strain is not necessarily homozygous - please verify before using. Cytoplasmic green fluorescence in intestinal cells visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (V:20.19). Insertion into pro-3 3'UTR. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1401 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection.

oxTi876 [vha-6p::GFP::tbb-2 3'UTR + Cbr-unc-119(+)] IV. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Cytoplasmic green fluorescence in intestinal cells visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (IV:4.53). Intergenic insertion. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1401 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection.

oxTi877 [vha-6p::GFP::tbb-2 3'UTR + Cbr-unc-119(+)] II. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Cytoplasmic green fluorescence in intestinal cells visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (II:-2.02). Insertion into ggr-3. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1401 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection.

oxTi878 [vha-6p::GFP::tbb-2 3'UTR + Cbr-unc-119(+)] V. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Cytoplasmic green fluorescence in intestinal cells visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (V:1.58). Insertion into B0507.6. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1401 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection.

oxTi879 [vha-6p::GFP::tbb-2 3'UTR + Cbr-unc-119(+)] V. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Cytoplasmic green fluorescence in intestinal cells visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (V:2.02). Insertion into H24G06.1. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1401 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection.

oxTi880 [vha-6p::GFP::tbb-2 3'UTR + Cbr-unc-119(+)] IV. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Cytoplasmic green fluorescence in intestinal cells visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (IV:1.82). Insertion into drp-1. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1401 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection.

oxTi882 [vha-6p::GFP::2xNLS::tbb-2 3'UTR + Cbr-unc-119(+)] II. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence in intestinal cells visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (II:0.13). Insertion into ncRNA C44B7.21. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1405 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection.

oxTi884 [vha-6p::GFP::2xNLS::tbb-2 3'UTR + Cbr-unc-119(+)] IV. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence in intestinal cells visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (IV:3.90). Intergenic insertion. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1405 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection.

oxTi885 [vha-6p::GFP::2xNLS::tbb-2 3'UTR + Cbr-unc-119(+)] X. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence in intestinal cells visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (X:9.13). Intergenic insertion. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1405 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection.

oxTi886 [myo-3p::GFP::tbb-2 3'UTR + Cbr-unc-119(+)] II. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Cytoplasmic green fluorescence in body wall muscles visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (II:-14.32). Insertion into T08E11.8. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1400 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection.

oxTi887 [myo-3p::GFP::tbb-2 3'UTR + Cbr-unc-119(+)] II. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Cytoplasmic green fluorescence in body wall muscles visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (II:2.59). Insertion into T08E11.8. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1400 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection.

oxTi888 [myo-3p::GFP::tbb-2 3'UTR + Cbr-unc-119(+)] V. Strain is healthy. Pick GFP+ non-Unc to maintain. NOTE: This strain is not necessarily homozygous - please verify before using. Cytoplasmic green fluorescence in body wall muscles visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (V:3.88). Intergenic insertion. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1400 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection.

oxTi889 [myo-3p::GFP::tbb-2 3'UTR + Cbr-unc-119(+)] V. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Cytoplasmic green fluorescence in body wall muscles visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (V:1.44). Insertion into F25G6.7. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1400 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection.

oxTi890 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + Cbr-unc-119(+)] X. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (X:-0.43). Intergenic insertion. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1661 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection.

oxTi891 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + Cbr-unc-119(+)] II. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (II:-0.61). Intergenic insertion. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1661 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection.

oxTi892 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + Cbr-unc-119(+)] III. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (III:-0.93). Insertion into srv-1. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1661 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection.

oxTi893 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + Cbr-unc-119(+)] X. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (X:0.57). Intergenic insertion. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1661 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection.

oxTi894 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + Cbr-unc-119(+)] V. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (V:11.54). Insertion into srh-131. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1661 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection.

oxTi895 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + Cbr-unc-119(+)] I. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (I:0.22). Insertion into klp-15. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1661 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection.