Search Strains

More Fields
Strain Species Genotype Add
EG8953 C. elegans oxTi1017 IV. Show Description
oxTi1017 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + NeoR] IV. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (IV:3.20). Intergenic insertion. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1659 into N2 with neomycin selection.
EG8954 C. elegans oxTi1018 I. Show Description
oxTi1018 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + NeoR] I. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (I:21.64). Intergenic insertion. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1659 into N2 with neomycin selection.
EG8955 C. elegans oxTi1019 X. Show Description
oxTi1019 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + NeoR] X. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (X:-7.36). Intergenic insertion. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1659 into N2 with neomycin selection.
EG8956 C. elegans oxTi1020 V. Show Description
oxTi1020 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + NeoR] V. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (V:-2.60). Insertion into C04F5.2. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1659 into N2 with neomycin selection.
EG8957 C. elegans oxTi1021 V. Show Description
oxTi1021 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + NeoR] V. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (V:6.85). Intergenic insertion. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1659 into N2 with neomycin selection.
EG8958 C. elegans oxTi1022 I. Show Description
oxTi1022 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + NeoR] I. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (I:22.34). Insertion into Y71A12B.8. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1659 into N2 with neomycin selection.
EG8959 C. elegans oxTi1023 IV. Show Description
oxTi1023 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + NeoR] IV. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (IV:4.05). Intergenic insertion. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1659 into N2 with neomycin selection.
EG8960 C. elegans oxTi1024 III. Show Description
oxTi1024 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + NeoR] III. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (III:-3.80). Intergenic insertion. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1659 into N2 with neomycin selection.
EG8961 C. elegans oxSi255 I; oxTi81 him-5(e1490) V. Show Description
oxSi255 [snt-1p::GFP + Cbr-unc-119(+)] I. Integration into ttTi4348 mosSCI site (I:-5.32). Pan-neuronal GFP expression visible under dissection microscope. oxTi81 [eft-3p::GFP::H2B::tbb-2 3'UTR + unc-18(+)] V. Nuclear, green fluorescence is broadly expressed (in most cells). Integration into chr.V: 1.21. Him. Combined fluorescent balancer strain for LG I and LG IV. Strain contains him-5(e1490) to generate males for crosses.
EG9876 C. elegans unc-119(ox819 oxTi1126) III. Show Description
oxTi1126 [mex-5p::Cas9(+smu-2 introns)::tbb-2 3'UTR + hsp-16.41p::Cre::tbb-2 3'UTR + myo-2p::2xNLS::cyOFP::let-858 3'UTR + lox2272] III. Knock-in into previously modified unc-119(ox819) endogenous locus. Cas9 insertion marked with myo-2p::cyOFP (cyan-excitable Orange Fluorescent Protein), a long-Stokes-shift fluorescent protein that is spectrally separable from common green and red fluorophores. The Cas9 transgene was optimized for germline expression by including 4 large PATC-rich introns from smu-2. Lower activity than other Cas9 strains, but useful because Cas9, Cre, and unc-119 are in a single unit. Reference: Schwartz ML, et al. High-efficiency CRISPR gene editing in C. elegans using Cas9 integrated into the genome. bioRxiv 2021.08.03.454883; doi: https://doi.org/10.1101/2021.08.03.454883
EG9881 C. elegans unc-119(ox819) F53A2.9(oxTi1127) III. Show Description
oxTi1127 [mex-5p::Cas9(+smu-2 introns)::tbb-2 3'UTR + hsp-16.41p::Cre::tbb-2 3'UTR + myo-2p::2xNLS::cyOFP::let-858 3'UTR + lox2272] III. Inserted into F53A2.9. High Cas9 activity. Integrated Cas9 transgene linked to unc-119(ox819). Cas9 insertion marked with myo-2p::cyOFP (cyan-excitable Orange Fluorescent Protein), a long-Stokes-shift fluorescent protein that is spectrally separable from common green and red fluorophores. Reference: Schwartz ML, et al. High-efficiency CRISPR gene editing in C. elegans using Cas9 integrated into the genome. bioRxiv 2021.08.03.454883; doi: https://doi.org/10.1101/2021.08.03.454883
EG9882 C. elegans F53A2.9(oxTi1127) III. Show Description
oxTi1127 [mex-5p::Cas9(+smu-2 introns)::tbb-2 3'UTR + hsp-16.41p::Cre::tbb-2 3'UTR + myo-2p::2xNLS::cyOFP::let-858 3'UTR + lox2272] III. Inserted into F53A2.9. High Cas9 activity. Superficially wild-type. Cas9 insertion marked with myo-2p::cyOFP (cyan-excitable Orange Fluorescent Protein), a long-Stokes-shift fluorescent protein that is spectrally separable from common green and red fluorophores. Reference: Schwartz ML, et al. High-efficiency CRISPR gene editing in C. elegans using Cas9 integrated into the genome. bioRxiv 2021.08.03.454883; doi: https://doi.org/10.1101/2021.08.03.454883
EJ1158 C. elegans gon-2(q388) I. Show Description
NOTE: Supplement media to 50 mM Mg2+ and grow at 15C for maximum fertility. Temperature-sensitive failure of gonad precursor divisions. Penetrance of Gon phenotype is high at 23.5C. At 25 degrees you can expect reduced brood sizes and some embryonic lethality. [Note: temperature sensitive period for gon-2(q388) begins prior to fertilization.] Reference: Sun AY & Lambie EJ. Genetics. 1997 Nov;147(3):1077-89.
EJ1171 C. elegans gon-2(q388) I; gem-1(bc364) X. Show Description
NOTE: Supplement media to 50 mM Mg2+ and grow at 15C for maximum fertility. The stock will propagate on non-supplemented media at 20 degrees, but this will potentially select for intragenic revertants of gon-2(q388). Temperature-sensitive failure of gonad precursor divisions. Penetrance of Gon phenotype is very high at 23.5C. At 25 degrees you can expect reduced brood sizes and some embryonic lethality. [Note: temperature sensitive period for gon-2(q388) begins prior to fertilization.] bc364 deletes 1,109 bp between AACATCTTGAATAACCATTCGGGAAGT and AAGTCATTCATTGCAGAGCTTACATTTAGTA. References: Kemp BJ, et al. Genetics. 2009 Feb;181(2):581-91. Sun AY & Lambie EJ. Genetics. 1997 Nov;147(3):1077-89.
EK228 C. elegans mbk-1(pk1389) X. Show Description
Homozygous viable. Weak olfaction defects at dilute concentrations of chemoattractants. Probable null allele.
EK273 C. elegans hpk-1(pk1393) X. Show Description
Homozygous viable. Males do not mate (or mate poorly). Probable null allele.
EKM11 C. elegans htz-1(tm2469) IV/nT1 [qIs51] (IV;V). Show Description
Maintain under normal condition. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP tm2469 homozygotes (Sterile). tm2469 m+z- are sterile adults. Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Reference: Petty EL, et al. PLoS Genet. 2009 Oct;5(10):e1000699. doi: 10.1371/journal.pgen.1000699. Csankovszki G, et al. (2009) Curr Biol 19(1):9-19. [NOTE: new stock received at CGC 05/26/2021. Original stock received in 2010 had broken down and was no longer segregating as expected.]
EKM4 C. elegans capg-1(tm1514) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Homozygous sterile deletion balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP tm1514 homozygotes (sterile, tm1514 m+z- are larval lethal). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Reference: Csankovszki G, et al. (2009) Curr Biol 19(1):9-19.
EL329 C. elegans ego-1(om58)/hT2 [dpy-18(h662)] I; +/hT2 [bli-4(e937)] III. Show Description
Heterozgyotes are WT and segregate WT, Steriles and Dpys. The Steriles produce small, abnormal oocytes; some dead embryos are produced in late adulthood. bli-4 is suppressed by dpy-1 in hT2 homozygotes-only see a very few DpyBli. om58 previously called ego-6(om58).
EL477 C. elegans iffb-1(bc367)/sC1 [dpy-1(s2170)] III. Show Description
Heterozygotes are WT and segregate WT, Dpy sC1 homozygotes, and bc367 homozygotes which arrest as late L1/early L2 larvae (survive for a few days, then die).
EL602 C. elegans cid-1&pup-2(om129)/qC1 [dpy-19(e1259) glp-1(q339)] nIs189 III. Show Description
Pick wild-type GFP+ to maintain. Heterozygotes are wild-type GFP+ (pharynx), and segregate wild-type GFP+ heterozygotes, Dpy Sterile GFP+, and non-GFP om129 homozygotes (reduced fertility, maternal effect embryonic lethality, and high incidence of male offspring). om129 homozygote defects become more severe over successive generations and are more severe at 25C. om129 is a CRISPR-engineered deletion completely removing cid-1 and pup-2 loci. cid-1 also known as pup-1. nIs189 [myo-2::GFP] integrated in or near qC1. No recombination seen between nIs189 and qC1; fails to complement all markers on qC1. Reference: Yang B, et al. PLoS Genet. 2019 Feb 22;15(2):e1007992. doi: 10.1371/journal.pgen.1007992. PMID: 30794539. Superficially wildtype strain expresses GFP in the pharynx and segregates GFP+ dumpy sterile qC1 homozygotes and homozygous pup-1/-2(om129) animals that have reduced fertility and maternal effect embryonic lethality and are Him. Phenotype becomes more severe over successive generations and is more severe at 25°C. Reference: Li Y, et al. Development. 2018 Oct 10;145(19):dev165944. doi: 10.1242/dev.165944. PMID: 30305273.
EL630 C. elegans smrc-1(om138)/qC1 [dpy-19(e1259) glp-1(q339)] nIs189 III. Show Description
Pick wild-type GFP+ to maintain. Heterozygotes are wild-type GFP+ (pharynx), and segregate wild-type GFP+ heterozygotes, Dpy Sterile GFP+, and non-GFP om138 homozygotes (reduced fertility, reduced embryonic viability and a high proportion of male offspring). om138 is a frameshift mutation. nIs189 [myo-2::GFP] integrated in or near qC1. No recombination seen between nIs189 and qC1; fails to complement all markers on qC1. Reference: Yang B, et al. PLoS Genet. 2019 Feb 22;15(2):e1007992. doi: 10.1371/journal.pgen.1007992. PMID: 30794539.
EL632 C. elegans smrc-1(om138) met-2(n4256)/qC1 [dpy-19(e1259) glp-1(q339)] nIs189 III. Show Description
Pick wild-type GFP+ to maintain. Heterozygotes are wild-type GFP+ (pharynx), and segregate wild-type GFP+ heterozygotes, Dpy Sterile GFP+, and non-GFP non-GFP smrc-1(om138) met-2(n4256) homozygotes (reduced fertility, reduced embryonic lethality, and produce a high frequency of male offspring). These phenotypes are more severe at 25C, and at 25C the subsequent M-Z- generation produces essentially no viable embryos. The smrc-1(om138) allele was generated with CRISPR/Cas9 on the met-2(n4256) chromosome. nIs189 [myo-2::GFP] integrated in or near qC1. No recombination seen between nIs189 and qC1; fails to complement all markers on qC1. Reference: Yang B, et al. PLoS Genet. 2019 Feb 22;15(2):e1007992. doi: 10.1371/journal.pgen.1007992. PMID: 30794539.
EL658 C. elegans smrc-1(om138) met-2(om142[3xflag::met-2])/qC1 [dpy-19(e1259) glp-1(q339)] nIs189 III. Show Description
Pick wild-type GFP+ to maintain. Heterozygotes are wild-type GFP+ (pharynx), and segregate wild-type GFP+ heterozygotes, Dpy Sterile GFP+, and non-GFP smrc-1(om138) met-2(om142) homozygotes (reduced fertility, reduced embryonic viability and high incidence of male offspring). Defects are more prominent in M-Z- animals at 25C. 3xFlag tag inserted at N-terminus of endogenous met-2 locus using Crispr/Cas9. nIs189 [myo-2::GFP] integrated in or near qC1. No recombination seen between nIs189 and qC1; fails to complement all markers on qC1. Reference: Yang B, et al. PLoS Genet. 2019 Feb 22;15(2):e1007992. doi: 10.1371/journal.pgen.1007992. PMID: 30794539.
EL680 C. elegans smrc-1(q136)/qC1 [dpy-19(e1259) glp-1(q339)] nIs189 III. Show Description
Pick wild-type GFP+ to maintain. Heterozygotes are wild-type GFP+ (pharynx), and segregate wild-type GFP+ heterozygotes, Dpy Sterile GFP+, and non-GFP q136 homozygotes (reduced fertility, reduced embryonic viability, and increased frequency of male offspring). q136 is a nonsense mutation. nIs189 [myo-2::GFP] integrated in or near qC1. No recombination seen between nIs189 and qC1; fails to complement all markers on qC1. Reference: Yang B, et al. PLoS Genet. 2019 Feb 22;15(2):e1007992. doi: 10.1371/journal.pgen.1007992. PMID: 30794539.
EL69 C. elegans unc-32(e189) glp-1(q231) III; sog-3(q294) IV. Show Description
Unc. Fertile with viable progeny at or below 20C. Glp-1 sterile at higher temperatures. No obvious visible phenotype associated with sog-3.
EL694 C. elegans pup-4(om140) II. Show Description
pup-4/F43E2.1. Maintain at 15-20C. Homozygotes produce <1% sterile individuals at 25C after multiple generations. ~10% of fertile individuals contain one infertile gonad arm. om140 is a CRISPR-engineered internal deletion removing most of the pup-4 coding sequence. Reference: Kelley L, et al. Development. 2024 Oct 7;228(2):iyae120. doi: 10.1093/genetics/iyae120. PMID: 39067069.
EL713 C. elegans pup-4(om141) II. Show Description
pup-4/F43E2.1. Maintain at 15-20C. Homozygotes produce <1% sterile individuals at 25C after multiple generations. ~10% of fertile individuals contain one infertile gonad arm. om141 is a CRISPR-engineered deletion removing the entire pup-4 coding sequence. Reference: Kelley L, et al. Development. 2024 Oct 7;228(2):iyae120. doi: 10.1093/genetics/iyae120. PMID: 39067069.
EM111 C. elegans him-5(e1490) V; mab-19(bx38) X. Show Description
Male phenotype: loss of rays 7-9; incomplete penetrance/expressivity (80%); T lineage defect. Hermaphrodite phenotype: lowered brood size (100 progeny/hermaphrodite). Hypomorphic allele: uDf1/mab-19(bx38) results in embryonic arrest during morphogenesis.
EM141 C. elegans unc-17(e113) col-34(bx25) IV; him-5(e1490) V. Show Description
Unc. Abnormal rays. bx25 previously called ram-4.
EM207 C. elegans tbx-2(bx59) III; him-5(e1490) V. Show Description
Conditional lethal: inviable when grown at 25C. Wild type at 16C. Viable when grown at 20C; partial ray loss at 20C. Shifting males during ray assembly to non-permissive temperature results in ray loss. No lineage defect.
EM305 C. elegans efn-4(bx80) IV; him-5(e1490) V. Show Description
Extensive ray fusion involving all 9 rays. Larva have Vab phenotype with decreasing expressivity in adult. Hermaphrodites have swollen tail and anus. bx80 pka mab-26(bx80).
EM331 C. elegans him-5(e1490) V; mab-19(bx83) X. Show Description
Male phenotype: loss of rays 7-9; incomplete penetrance/expressivity (80%); T lineage defect. Hermaphrodite phenotype: lowered brood size (100 progeny/hermaphrodite). Hypomorphic allele: uDf1/mab-19(bx83) results in embryonic arrest during morphogenesis.
EM434 Pellioditis pelhamensis Pellioditis pelhamensis wild isolate. Show Description
WT strain, Pellioditis pelhamensis. See WBG 12(5)14. Male/Female strain. Previously and incorrectly called Rhabditis maupasi by the CGC. Also previously called DF5039.
EM435 Oscheius myriophilus Oscheius myriophilus wild isolate. Show Description
WT strain. Isolated by D. Fitch in June 1990 from soil in Scott Emmons' compost heap in the Fort Greene section of Brooklyn, NY. A second strain, DF5038, was isolated from the same location one year later from the head and ventral segments of a male pill bug (Armadillidium vulgare). Hermaphroditic. Males are easily isolated by heat shocking L4 or early adult hermaphrodites at 30C for 6-12 hrs. Grows well at 6-25C on OP50. Dauer larvae accumulate under starved or overcrowded conditions. Freezes easily using C. elegans protocols with 90% viability. Previously called Rhabditis sp. See also WBPaper00003418. Formerly known as Oscheius myriophila.
EM437 Pelodera teres Show Description
WT strain, Pelodera teres. See WBG 12(5) 14. Male/Female strain. Previously called DF5016.
EM464 C. remanei ssp. vulgaris Show Description
Male-female strain. Reference WBG 11(4):89. See also WBPaper00001874. May crawl off the plates. Previously called C. vulgaris BK and C. vulgariensis BK. Walter Sudhaus has tentatively described this strain as C. remanei ssp. vulgaris; this description is not official and is contigent upon its being published. See WBPaper00002633 and WBPaper00003993.
EM489 C. elegans pal-1(e2091) III; him-5(e1490) V; dpy-22(bx92) X. Show Description
V6 produces rays instead of alae in pal-1; sop01 mutants. No obvious phenotype in a pal-1(+) background. Previously called sop-1(bx92).
EM490 C. elegans pal-1(e2091) III; him-5(e1490) V; dpy-22(bx93) X. Show Description
V6 produces rays instead of alae in pal-1; sop01 mutants. No obvious phenotype in a pal-1(+) background. Previously called sop-1(bx93).
EM507 C. elegans pal-1(e2091) III; him-5(e1490) V; dpy-22(bx103) X. Show Description
V6 produces rays instead of alae in pal-1; sop-1 mutants. No obvious phenotype in a pal-1(+) background. Previously called sop-1(bx103).
EM511 C. elegans pal-1(e2091) III; him-5(e1490) V; dpy-22(bx107) X. Show Description
V6 produces rays instead of alae in pal-1; sop01 mutants. No obvious phenotype in a pal-1(+) background. Previously called sop-1(bx107).
EM68 C. elegans col-34(bx25) IV; him-5(e1490) V. Show Description
Lumpy rays. Temperature sensitive. bx25 previously called ram-4.
EM938 C. elegans pdfr-1(bx142) III; him-5(e1490) V. Show Description
Male leaving assay defective (Las), lethargic, hypereversal. Reference: Barrios, A, et al. Nat Neurosci. 2012 Dec;15(12):1675-82.
ER10 C. elegans unc-123(jd5) III. Show Description
Temperature sensitive, semidominant mutant that is Unc when moving backward. Dorsal muscular contraction is stronger than that of ventral, resulting in an asymmetric pattern of locomotion in which the animal either forms a dorsal coil or moves in circles with the dorsal side central to the circle. Most likely a gain of function allele of sup-1.
ERT691 C. elegans rcs-1(jy84) X. Show Description
Full CRISPR deletion of rcs-1 via CRISPR in a dpy-10 background, outcrossed 3x to wild-type. Superficially wild-type. Reference: Panek J, et al. Proc Natl Acad Sci USA. .2020 Apr 7;117(14):7950-7960. doi: 10.1073/pnas.1918417117. PMID: 32193347.
ERT848 C. elegans fbxa-75(jy143) III. Show Description
Full CRISPR deletion of fbxa-75 via CRISPR in a dpy-10 background, outcrossed 3x to wild-type. Superficially wild-type. Reference: Panek J, et al. Proc Natl Acad Sci USA. .2020 Apr 7;117(14):7950-7960. doi: 10.1073/pnas.1918417117. PMID: 32193347.
ERT852 C. elegans fbxa-158(jy145) II. Show Description
Full CRISPR deletion of fbxa-158 via CRISPR in a dpy-10 background, outcrossed 3x to wild-type. Superficially wild-type. Reference: Panek J, et al. Proc Natl Acad Sci USA. .2020 Apr 7;117(14):7950-7960. doi: 10.1073/pnas.1918417117. PMID: 32193347.
ET100 C. elegans H01G02.2(ok200) IV. Show Description
H01G02.2. External left primer: TGCATCCCTTTGATTCCTTC. External right primer: AAACCTGGGCGCTTTTATTT. Internal left primer: GCAATCCTTGCTTGATCCAT. Internal right primer: TGATTGCAACGTTCCATGAT. Internal WT amplicon: 3033 bp. Deletion size: 1251 bp. Deletion left flank: AAACTCACTTTTGAAACATTCGGGACCATT. Deletion right flank: GATGAAGATCATGGAACGTTGCAATCAATT. This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. URL: http://www.celeganskoconsortium.omrf.org.
ET137 C. elegans C30G12.1(ok910) II. Show Description
C30G12.1 Homozygous. No overt morphological or behavioral abnormalities. 1286 bp deletion. The region of cosmid C30G12 that is deleted is 39,238 - 40,523 bps (inclusive). The deletion includes an ectopic 5 bp sequence, GGTTA. The sequence crossing the deletion for ok910 is: ....GCCATGGTTAAAAGT GGTTA AAAAATTCAGTATAT... This deletion was generated by the C. elegans Gene Knockout Project at OMRF, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publication resulting from its use. http://www.mutantfactory.ouhsc.edu/
ET507 C. elegans daf-16(mu86) I; cki-2(ok2105) II; glp-1(ar202) III. Show Description
Temperature-sensitive. Maintain at 15C. Animals form germline tumors that prevent fertility at restrictive temerature (25C). This is the first strain reported to be used for the isolation of germ cells for in vitro culture. This strain allows germ cells to remain viable for longer periods than other tumorous mutant strains tested. Reference: Chaudhari SH, et al. Dev Cell. 2016 Jul 11;38(1):33-46.