Strain Information

Name ZT3   View On Wormbase
Species C. elegans
Genotypecsr-1(fj54) IV/nT1 [qIs51] (IV;V).
DescriptionHeterozygotes are WT and GFP+. csr-1 homozygotes are basically sterile, but some of them occasionally lay a small number of dead eggs. The fj54 mutation deletes a 524 bp region including half of the second exon, the third exon, and almost all of the fourth exon, causing a frame shift to stop the translation of both PAZ and Piwi domains. The deletion can be checked by PCR with the following primers: AAGAAATACCAATGCGGAGGCA and TTCACGGCTCTTTGCAGTTTCA. Homozygous nT1[qIs51] inviable.
MutagenUV/TMP
Outcrossedx1
Made byMoriguchi/Tabara
Laboratory ZT
Sign in or register an account if you want to order this strain.