Strain Information
| Name | ZT3 View On Wormbase |
|---|---|
| Species | C. elegans |
| Genotype | csr-1(fj54) IV/nT1 [qIs51] (IV;V). |
| Description | Heterozygotes are wild-type with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP csr-1(fj54) homozygotes (sterile, but some animals lay a small number of dead eggs). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. The fj54 mutation deletes a 524 bp region including half of the second exon, the third exon, and almost all of the fourth exon, causing a frame shift to stop the translation of both PAZ and Piwi domains. The deletion can be checked by PCR with the following primers: AAGAAATACCAATGCGGAGGCA and TTCACGGCTCTTTGCAGTTTCA. |
| Mutagen | UV/TMP |
| Outcrossed | x1 |
| Made by | Moriguchi/Tabara |
| Laboratory | ZT |
Sign in
or
register an account if you want to order this strain.