More Fields
Strain Species Genotype
BAY7 C. elegans yanSi1 II; unc-119(ed3) III. Show Description
yanSi1 [eft-3p::dCAS9::VP64::tbb-2 3'UTR + Cbr-unc-119(+)] inserted into ttTi5605 (II:8.42 MB) in parental strain EG6699. Integration plasmid was generated via 3-way gateway reaction with pCFJ150 and plasmids containing eft-3 promoter (ID:1031@E02 promoterome), tbb-2 3'UTR (pCM1.36), and a full length dcas9::VP64 transgene cloned into pDONR201. Reference: Zullo JM, et al. Nature. 2019 Oct;574(7778):359-364. doi: 10.1038/s41586-019-1647-8. PMID: 31619788.
CV203 C. elegans rjSi1 II. Show Description
rjSi1 [cra-1p::cra-1::GFP::cra-1 3'UTR + Cbr-unc-119(+)] II. Single copy insertion. cra-1 promoter, cra-1::GFP and 3'UTR was cloned into pCFJ150 (ttTi5605) vector and inserted into ttTi5605 of EG4322 strain. Outcrossed three times to N2 Bristol; could still carry unc-119(ed9) in the background. Superficially wild-type. This CRA-1::GFP fusion construct has been shown to be functional and its localization reflects endogenous CRA-1 localization. rjSi1 transgene can rescue synapsis defects of cra-1 mutants and restore cross-over events (six bivalents instead of the 11 to 12 univalents characteristic of cra-1 mutants). Brood size and embryonic lethality were significantly, albeit not completely, restored in the rescued line suggesting that the GFP tag might affect other CRA-1 functions. Reference: Gao J, et al. PLOS Genetics 11(3): e1005029. https://doi.org/10.1371/journal.pgen.1005029
EG8078 C. elegans oxTi185 I; unc-119(ed3) III. Show Description
oxTi185 [ttTi5605 + NeoR(+) + unc-18(+)]. Unc. Grows best at 20C on HB101. Strain contains a universal MosSCI insertion site that is compatible with targeting vectors for the ttTi5605 site (for example, pCFJ150 derivatives). This site is generally permissive for germline expression. Transgenic animals are NeoR and carry an extra copy of unc-18(+). Please see www.wormbuilder.org for more details.
EG8079 C. elegans oxTi179 II; unc-119(ed3) III. Show Description
oxTi179 [ttTi5605 + NeoR(+) + unc-18(+)]. Unc. Grows best at 20C on HB101. Strain contains a universal MosSCI insertion site that is compatible with targeting vectors for the ttTi5605 site (for example, pCFJ150 derivatives). This site is generally permissive for germline expression. Transgenic animals are NeoR and carry an extra copy of unc-18(+). Please see www.wormbuilder.org for more details.
EG8080 C. elegans oxTi444 unc-119(ed3) III. Show Description
oxTi444 [ttTi5605 + NeoR(+) + unc-18(+)]. Unc. Grows best at 20C on HB101. Strain contains a universal MosSCI insertion site that is compatible with targeting vectors for the ttTi5605 site (for example, pCFJ150 derivatives). This site is generally permissive for germline expression. Transgenic animals are NeoR and carry an extra copy of unc-18(+). Please see www.wormbuilder.org for more details.
EG8081 C. elegans unc-119(ed3) III; oxTi177 IV. Show Description
oxTi177 [ttTi5605 + NeoR(+) + unc-18(+)]. Unc. Grows best at 20C on HB101. Strain contains a universal MosSCI insertion site that is compatible with targeting vectors for the ttTi5605 site (for example, pCFJ150 derivatives). This site is generally permissive for germline expression. Transgenic animals are NeoR and carry an extra copy of unc-18(+). Please see www.wormbuilder.org for more details.
EG8082 C. elegans unc-119(ed3) III; oxTi365 V. Show Description
oxTi365 [ttTi5605 + NeoR(+) + unc-18(+)]. Unc. Grows best at 20C on HB101. Strain contains a universal MosSCI insertion site that is compatible with targeting vectors for the ttTi5605 site (for example, pCFJ150 derivatives). This site is generally permissive for germline expression. Transgenic animals are NeoR and carry an extra copy of unc-18(+). Please see www.wormbuilder.org for more details.
EG8083 C. elegans unc-119(ed3) III; oxTi354 V. Show Description
oxTi354 [myo-2p::GFP::H2B + ttTi5605 + unc-18(+)]. Unc. Grows best at 20C on HB101. Strain contains a universal MosSCI insertion site that is compatible with targeting vectors for the ttTi5605 site (for example, pCFJ150 derivatives). This site is generally permissive for germline expression. Transgenic animals contain a myo-2p::GFP::H2B construct next to the insertion site and carry an extra copy of unc-18(+). Please see www.wormbuilder.org for more details.
KAE12 C. elegans seaSi182 II; unc-119(ed3) III. Show Description
seaSi182 [(pCFJ150) (vha-6p::fmo-2 + H2B::GFP) + Cbr-unc-119(+)] II. Over-expression of FMO-2 in the intestine. Long-lived. Reference: Leiser SF, et al. Science 350.6266 (2015): 1375-8.
VT3118 C. elegans unc-119(ed3) III; mir-83(n4638) IV; mir-34(gk437) X; maEx246. Show Description
maEx246 (cdc-42p::GFP::H2B::cdc-42(mutated) 3`UTR + cdc-42p::mCherry::H2B::cdc-42 3`UTR + pBluescript + pIF9 unc-119(+) + pCFJ150 + pCFJ210). Pick non-Unc to maintain. Reference: Burke SL, Hammell M, Ambros V. Genetics. 2015 Jun 15.
VT3136 C. elegans unc-119(ed3) III; maEx246. Show Description
maEx246 (cdc-42p::GFP::H2B::cdc-42(mutated) 3`UTR + cdc-42p::mCherry::H2B::cdc-42 3`UTR + pBluescript + pIF9 unc-119(+) + pCFJ150 + pCFJ210). Pick non-Unc to maintain. Reference: Burke SL, Hammell M, Ambros V. Genetics. 2015 Jun 15.
VT3145 C. elegans unc-119(ed3) III; mir-83(n4638) IV; mir-34(gk437) X; maEx247. Show Description
maEx247 (pat-3p::GFP::H2B::pat-3(mutated) 3`UTR + pat-3p::mCherry::H2B::pat-3 3`UTR + pBluescript + pIF9 unc-119(+) + pCFJ150 + pCFJ210). Pick non-Unc to maintain. DTC migration defects. Reference: Burke SL, Hammell M, Ambros V. Genetics. 2015 Jun 15.
VT3178 C. elegans unc-119(ed3) III; maEx247. Show Description
maEx247 (pat-3p::GFP::H2B::pat-3(mutated) 3`UTR + pat-3p::mCherry::H2B::pat-3 3`UTR + pBluescript + pIF9 unc-119(+) + pCFJ150 + pCFJ210). Pick non-Unc to maintain. Reference: Burke SL, Hammell M, Ambros V. Genetics. 2015 Jun 15.
ZT63 C. elegans csr-1(fj150) IV. Show Description
RNAi deficient (Rde). Him. Partially-inaccurate paring of meiotic chromosomes. fj150 is a mutation changing WK to FS and generating a new FspI site in the second K-rich region between the PAZ and Piwi domains. The fj150 mutation can be detected by PCR with the following primers: TCGGATGTTGACTACAACGC and GAAGGTAGAAACTTCATTCCAGCAC, followed by digestion with FspI. Reference: Tabara H, et al. (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002.
ZT64 C. elegans csr-1(fj150) IV; fjDf1 fjDf2 fjDf3 fjDf4 X. Show Description
fj150 is a mutation changing WK to FS and generating a new FspI site in the second K-rich region between the PAZ and Piwi domains. fj150 is enhanced by the CeRep55 quadruple deletion. The fj150 mutation can be detected by PCR with the following primers: TCGGATGTTGACTACAACGC and GAAGGTAGAAACTTCATTCCAGCAC, followed by digestion with FspI. This strain lacks four major clusters of CeRep55 repeats on the X chromosome. The condensation of unpaired X chromosomes in male testes is insufficient. CeRep55 is a class of minisatellite sequences consisting of a 27-nt tandem repeat that is present on all chromosomes. Some CeRep55 clusters express long non-coding RNAs and small RNAs. Each of the four deletion sites was designed to acquire a sequence tag (TGTACAGGAAACAGCTATGACC; similar to M13 reverse) instead of the CeRep55 tandem repeats. The deletions of CeRep55 clusters can be checked by PCR with the following primers: fjDf1 in Y73B3A, CAACCTGACTCTCGCCAAGAC and GGAGAAGTAGGCGTGTCAGTTA; fjDf2 in Y75D11A, CAAGTGCCAAACTAGACTGCTC and TTCAAAACGCTACGCGATACCAG; fjDf3 in Y81B9A, AAATGCCCCTATCTCACAGTGG and GACTGCTAGAATCTGACTCGTC; fjDf4 in Y49A10A, CTCTTCCATTTCCAGTACAACCAG and GTTTCTATGGCTAGAGTCGTATGGTTAC. The PCR check can also be performed with the M13 reverse primer and the right-side primer. Reference: Tabara H, et al. (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002.