| AA120 |
C. elegans |
dhIs26. Show Description
dhIs26 [daf-12a::GFP + lin-15(+)]. DAF-12::GFP localized primarily in nucleus, except during mitosis. Expressed widely in most cells including tissues modified for dauer formation or by stage from embryo to adult, but most elevated and widespread during L2.
|
|
| AA278 |
C. elegans |
dhIs59. Show Description
dhIs59 [Topo::daf-9::GFP + lin-15(+)]. Perinuclear expression in a ventral pair of bilateral neurons identified as the IL1Vs or URAVs in the anterior ganglia. By mid-L2, expression in the cytoplasm of the hypodermis, the syncitial epidermis, but absent from midline, epidermal seam cells. Levels peak around the L2 molt and diminish during L4. In some cases, transient expression seen in the L3 vulval blast cells. Also expressed within the hermaphrodite spermatheca starting in late L4 larvae and continuing eve in old adults. In males, expression in IL1V/URAVs and hypodermis but not somatic gonad. In dauer larvae, strong expression in IL1V/URAV and specifically extends into axonal but not dendritic processes. In post-dauer stages, expression in a pattern similar to reproductively growing animals, except expression is absent in the hypodermis. Grow at 20C. May still contain lin-15(n765) mutation in the background.
|
|
| AA426 |
C. elegans |
dre-1(dh99) V. Show Description
Precocious fusion of seam cells one stage earlier (prior to L3 molt); impenetrant gonadal migration defects; SynMig on daf-12 RNAi.
|
|
| AA699 |
C. elegans |
din-1(hd36) II. Show Description
non-Daf. Temperature-sensitive phenotypes: at 20C half of the animals are egg-laying defective with occasional mispositioned gonadal arms; at 25C, 18% arrest as embryos: those animals that hatch usually display variable morphology defects in body and pharynx; nearly all animals that live to adults are small, clear, slightly uncoordinated, constipated, and virtually sterile. Maintain at 20C or below.
|
|
| AA790 |
C. elegans |
lin-15B&lin-15A(n765) X; dhEx343. Show Description
dhEx343 [din-1p::din-1E::GFP + lin-15(+)]. Pick GFP+ to maintain. Animals with the array are GFP+ and non-Muv. Animals which have lost the array are Muv and non-GFP. din-1s::GFP is detected in hypodermis, seam, intestine, and somatic gonad including the distal tip cells. din-1s is also expressed in neurons, vulval precursors, body wall muscle, pharynx, and all tissues with heterochronic phenotypes or remodeled during dauer. Expression is first detected in a few nuclei by the comma stage of embryogenesis. By hatching, din-1s was widely expressed, albeit weakly. Overall expression in most tissues is detected at various levels into adult and in dauer larvae. Animals with the array are GFP+ and non-Muv. Animals which have lost the array are Muv and non-GFP. din-1p::din-1E::GFP was produced by cloning into Fire Lab vector L3781.
|
|
| AB1 |
C. elegans |
C. elegans wild isolate. Show Description
Reference WBG 10(2) 140-141 and WBG 8(2) 52. Caenorhabditis elegans wild isolate. (Tc1 pattern VII). For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).
|
|
| AB2 |
C. elegans |
C. elegans wild isolate. Show Description
Reference WBG 10(2) 140-141 and WBG 8(2) 52. Caenorhabditis elegans wild isolate. (Tc1 pattern VIII). For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).
|
|
| AB3 |
C. elegans |
C. elegans wild isolate. Show Description
Reference WBG 10(2) 140-141 and WBG 8(2) 52. Caenorhabditis elegans wild isolate. (Tc1 pattern VIII). For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).
|
|
| AB4 |
C. elegans |
C. elegans wild isolate. Show Description
Reference WBG 10(2) 140-141 and WBG 8(2) 52. Caenorhabditis elegans wild isolate. (Tc1 pattern VIII). For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).
|
|
| ABR1 |
C. elegans |
pha-1(e2123) III; staEx1. Show Description
staEx1 [T20F7.6p + pha-1(+)]. Empty vector control strain. Maintain at 25 degrees. Superficially wild-type. Reference: Greer EL et al Curr Biol 2007 Oct 9;17(19):1646-56.
|
|
| ABR16 |
C. elegans |
shEx1. Show Description
shEx1 [ges-1p::fat-7 + myo-3p::mCherry]. Pick mCherry+ to maintain. FAT-7 over-expressing strain. ABR14 serves as a control strain for this strain. Reference: Han S, et al. Nature 2017 doi: 10.1038/nature21686.
|
|
| ABR339 |
C. elegans |
lpin-1(wbm76[lpin-1::GFP]) V. Show Description
GFP tag inserted into endogenous lpin-1 locus. The strain was generated by using 5' attgttgctggcatcaaaaa crRNA for C-terminal lpin-1 editing and using dpy-10 editing as a co-conversion marker, followed by outcrossing twice to ABR lab stock of N2 to eliminate the dpy-10 co-conversion marker. Reference: Papsdorf et al, Nature Cell Biology, 2023, PMID 37127715. [NOTE: This strain was incorrectly named WBM1369 lpin-1(sta10[lpin-1::GFP]) in an earlier version of the paper.]
|
|
| ABR5 |
C. elegans |
unc-119(ed3) III; staIs1. Show Description
staIs1 [pie-1p::GFP + unc-119(+)]. Superficially wild-type. Maintain under normal conditions. Reference: This strain was used as the empty vector control in Greer EL et al Nature 2010 doi: 10.1038/nature09195.
|
|
| AC456 |
C. elegans |
aph-1(tm4743)/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Heterozygous. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP tm4743 homozygotes (Egl, Mel, adult-onset sterility). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Only heterozygous animals should propagate. aph-1(tm4743) deletion allele was generated by the National BioResource Project of Japan, part of the International C. elegans Gene Knockout Consortium. Reference: Brinkley DM, et al. Genetics. 2024 Jul 8;227(3):iyae076. doi: 10.1093/genetics/iyae076. PMID: 38717968.
|
|
| AC552 |
C. elegans |
aph-2(tm6471)/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Heterozygous. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP tm4743 homozygotes (Egl, Mel, but do not display adult-onset sterility). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Only heterozygous animals should propagate. aph-2(tm6471) deletion allele was generated by the National BioResource Project of Japan, part of the International C. elegans Gene Knockout Consortium. Reference: Brinkley DM, et al. Genetics. 2024 Jul 8;227(3):iyae076. doi: 10.1093/genetics/iyae076. PMID: 38717968.
|
|
| AC722 |
C. elegans |
aph-2(ik7)/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Heterozygous. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ik7 homozygotes (Egl, Mel, but do not display adult-onset sterility). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Only heterozygous animals should propagate. aph-2(ik7) is a CRISPR-engineered full deletion of the aph-2 gene (3321 bp deletion). Reference: Brinkley DM, et al. Genetics. 2024 Jul 8;227(3):iyae076. doi: 10.1093/genetics/iyae076. PMID: 38717968.
aph-2(ik7) is the first full deletion of the aph-2 gene (3321 bp deletion); it was generated by CRISPR/Cas9, as described in Brinkley et al. 2024
Homozygous aph-2(ik7) animals are Egl and Mel and do not display adult-onset sterility (see Brinkley et al, 2024).
Only heterozygous animals from this strain will propagate.
|
|
| AD226 |
C. elegans |
egg-3(tm1191)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP+ (heterozygotes), Dpy bright GFP+ (mIn1 homozygotes), and non-GFP tm1191 homozygotes. Pick WT dim GFP and check for correct segregation of progeny to maintain.
|
|
| AD266 |
C. elegans |
egg-4(tm1508) egg-5(ok1781) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP tm1508 ok1781 homozygotes (maternal sterile). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Reference: Parry JM, et al 2009 Current Biology 19(20):1752-7.
|
|
| ADS1002 |
C. elegans |
aeaIs10. Show Description
aeaIs10 [rgef-1p::GCaMP6s::3xNLS + lin-15(+)]. Worms express GCaMP6s in all neuronal nuclei. Pan-neuronal imaging strain; suitable for rapid whole-brain imaging due to brightness, good signal to noise ratio, and relative resistance to photo-bleaching. Reference: Susoy V, et al. Cell. 2021 Sep 30;184(20):5122-5137.e17. PMID: 34534446
|
|
| AE501 |
C. elegans |
nhr-8(ok186) IV. Show Description
Approx. 1.3 kb deletion - does not remove entire coding region, might not be null allele. No overt morphological or behavioral abnormalities. Homozygotes are 2-3X more sensitive to colchicine and chloroquine than are N2 animals.
|
|
| AF16 |
C. briggsae |
C. briggsae wild isolate. Show Description
See WBG 7(1) 48. Isolated from soil in Ahmedabad, India. Previously called C. briggsae G16. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).
|
|
| AF272 |
Unknown species |
Show Description
Dark in color.
|
|
| AF78 |
Mesorhabditis sp. |
Show Description
Rhabditidae: Mesorhabditis sp. Isolated in Governor Dodge State Park in South Dakota. Dark in color.
|
|
| AFS205 |
C. elegans |
zen-4(cle5) IV. Show Description
Temperature-sensitive embryonic-lethal mutant. Maintain at 15C. Shift L4s to 25C overnight to observe mutant phenotype of embryos produced by adults. Mutants lack a central spindle during early embryonic mitosis and exhibits a late cytokinesis defect (cleavage furrows regress after ingressing in nearly to the center of dividing embryonic cells). This strain can be used for CRISPR-Cas9 co-conversion. There is a causal mis-sense mutation present in zen-4(cle5), GAC to AAC (D520N), and one silent mutation, GCA to GCT at codon 519, that introduces an AluI site for RFLP analysis. A previous deposited version of this strain, zen-4(ok153), possessed two mis-sense mutations: GAC to AAC (D520N) and GAT to AAT (D735N). Reference: Farboud B, et al. Genetics Early online November 30, 2018; https://doi.org/10.1534/genetics.118.301775.
|
|
| AFS222 |
C. elegans |
zen-4(cle10) IV. Show Description
Temperature-sensitive embryonic-lethal mutant. Maintain at 15C. Shift L4s to 25C overnight to observe mutant phenotype of embryos produced by adults. Mutants lack a central spindle during early embryonic mitosis and exhibits a late cytokinesis defect (cleavage furrows regress after ingressing in nearly to the center of dividing embryonic cells). This strain can be used for CRISPR-Cas9 co-conversion. There is a causal mis-sense mutation present in zen-4(cle10), GAC to AAC (D520N), and two silent mutations. One silent mutation is a CGA to CGG mutation at codon 523 that creates a recognition site for a Cas9 guide RNA, in order to use zen-4(cle10ts) as a CRISPR/Cas9 co-conversion marker. The other silent mutation is a GCA to GCT mutation at codon 519 that introduces an AluI site for RFLP analysis. Reference: Farboud B, et al. Genetics Early online November 30, 2018; https://doi.org/10.1534/genetics.118.301775.
|
|
| AG226 |
C. elegans |
rol-6(e187) unc-4 (e120)/mnC1 [dpy-10(e128) unc-52(e444) nIs190 let-?] II; him-8(e1489) IV. Show Description
nIs190 [myo-2::GFP]. Him. Heterozygotes are wild-type GFP+ and segregate WT GFP+ heterozygotes, Rol Uncs, dead embryos, and males. nIs190 [myo-2::GFP] integrated in or near mnC1. Approx 0.5% recombination seen between nIs190 and mnC1. Fails to complemement all markers on mnC1.
|
|
| AG247 |
C. elegans |
tyms-1(tm2429) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Homozygous lethal deletion balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP+, arrested hT2 aneuploids, and non-GFP tm2429 homozygotes (embryonic lethal). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP+ and check for correct segregation of progeny to maintain. Reference: Jaramillo-Lambert A, et al. G3 (2015).
|
|
| AG248 |
C. elegans |
mus-101(tm1761) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Homozygous lethal deletion balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP+, arrested hT2 aneuploids, and non-GFP tm1761 homozygotes (embryonic lethal). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP+ and check for correct segregation of progeny to maintain. Reference: Jaramillo-Lambert A, et al. G3 (2015).
|
|
| AGD926 |
C. elegans |
zcIs4 V; uthIs269. Show Description
zcIs4 [hsp-4::GFP] V. uthIs269 [sur-5p::hsf-1::unc-54 3'UTR + myo-2p::tdTomato::unc-54 3' UTR]. ER stress resistence. Reference: Taylor RC, Dillin A. Cell. 2013 Jun 20;153(7):1435-47.
|
|
| AGD927 |
C. elegans |
uthIs270. Show Description
uthIs270 [rab-3p::xbp-1s (constitutively active) + myo-2p::tdTomato]. Pick animals with red pharynx to maintain. Reference: Taylor RC, Dillin A. Cell. 2013 Jun 20;153(7):1435-47.
|
|
| AGK192 |
C. elegans |
unc-119(ed3) III; zdIs13 IV; armIs5. Show Description
zdIs13 [tph-1p::GFP] IV. armIs5 [zfp-1(fosmid)::FLAG + unc-119(+)]. Integrated zfp-1 transgene expressed in the germline. Fosmid-based zfp-1::FLAG transgene fully rescues stress-sensitivity and reduced lifespan in zfp-1(ok554) homozygotes. ChIP with anti-FLAG antibody detects ZFP-1::FLAG localization to promoters of highly expressed genes. References: Mansisidor AR, et al. PLoS Genet. 2011 Sep;7(9):e1002299. Avgousti DC, et al. Mol Cell Biol. 2013 Mar;33(5):999-1015. Cecere G, et al. Mol Cell. 2013 Jun 27;50(6):894-907.
|
|
| AGK233 |
C. elegans |
unc-119(ed3) III; niDf199 IV; armEx58. Show Description
armEx58 [WRM0611aH08-Del8mer + unc-119(+)]. Pick non-Unc to maintain. This strain contains a transgenic array that expresses a derivative WRM0611aH08 fosmid. The WRM0611aH08 fosmid contains the niDF199 locus (around 4 kb) that is deleted in the natural C. elegans isolate strain JU258. JU258 worms lack specific 21U-RNAs normally present in N2 worms due to this deletion of the niDF199 locus. This derivative fosmid construct lacks the upstream 8-mer motif (CTGTTTCA) next to 21U-3372. The expression of this individual 21U-RNA is lost in transgenic animals. unc-119(ed3) was crossed into JU258, the niDf199IV deletion was confirmed by PCR, and these Unc worms were used for bombardment. Reference: Cecere G, et al. Mol Cell. 2012 Sep 14;47(5):734-45.
|
|
| AGK234 |
C. elegans |
unc-119(ed3) III; niDf199 IV; armEx53. Show Description
armEx53 [WRM0611aH08 + unc-119(+)]. Pick non-Unc to maintain. unc-119(ed3) was crossed into JU258, the niDf199IV deletion was confirmed by PCR, and these Unc worms were used for bombardment. This strain contains a transgenic array that expresses the WRM0611aH08 fosmid construct. This fosmid contains the niDF199 locus (around 4 kb) that is deleted in the natural C. elegans isolate strain JU258. JU258 worms lack specific 21U-RNAs normally present in N2 worms due to this deletion of the niDF199 locus. Expression of this fosmid construct in JU258 worms restores the expression of the missing 21U-RNAs in the germline, as measured by RT-qPCR. Reference: Cecere G, et al. Mol Cell. 2012 Sep 14;47(5):734-45.
|
|
| AGK26 |
C. elegans |
unc-119(ed3) III; armEx5. Show Description
armEx5 [zfp-1(fosmid)::GFP + unc-119(+)]. Pick non-Unc to maintain. Fosmid-based zfp-1::GFP transgene fully rescues stress-sensitivity and reduced lifespan in zfp-1(ok554) homozygotes. Nuclear expression of zfp-1::GFP is observed ubiquitously in somatic cells in all developmental stages; high levels of GFP expression is observed in oocytes with lower levels of expression in the distal germline. References: Mansisidor AR, et al. PLoS Genet. 2011 Sep;7(9):e1002299. Avgousti DC, et al. Mol Cell Biol. 2013 Mar;33(5):999-1015.
|
|
| AGK369 |
C. elegans |
zfp-1(ok554) III; armIs8. Show Description
armIs8 [zfp-1(short isoform)::FLAG::GFP + rol-6(su1006)]. Rollers. The fosmid-based armIs8 transgene rescues the protruded vulva phenotype of zfp-1(ok554). Ubiquitous nuclear localization of zfp-1(long isoform)::FLAG::GFP is observed in somatic cells in all developmental stages, but is silenced in the germline. See AGK26 for germline-expressing zfp-1::GFP. Reference: Avgousti DC, et al. Mol Cell Biol. 2013 Mar;33(5):999-1015.
|
|
| AGK370 |
C. elegans |
zfp-1(ok554) III; armIs9. Show Description
armIs9 [zfp-1(long isoform)::FLAG::GFP + rol-6(su1006)]. Rollers. The fosmid-based armIs9 transgene rescues zfp-1(ok554)/nDf17 lethality. Ubiquitous nuclear localization of zfp-1(long isoform)::FLAG::GFP is observed in somatic cells in all developmental stages, but is silenced in the germline. See AGK26 for germline-expressing zfp-1::GFP. Reference: Avgousti DC, et al. Mol Cell Biol. 2013 Mar;33(5):999-1015.
|
|
| AGK532 |
C. elegans |
unc-119(ed3) III; niDf199 IV; armEx196. Show Description
armEx196 [mex-5p::unc-130::GFP::tbb-2 3'UTR + Cbr-unc-119(+)]. Pick non-Unc to maintain. unc-119(ed3) was crossed into JU258, the niDf199IV deletion was confirmed by PCR, and these Unc worms were used for bombardment. JU258 worms lack specific 21U-RNAs normally present in N2 worms due to deletion of the niDF199 locus. Reference: Cecere G, et al. Mol Cell. 2012 Sep 14;47(5):734-45. Reference: Cecere G, et al. Mol Cell. 2012 Sep 14;47(5):734-45.
|
|
| AGK650 |
C. elegans |
daf-16(mu86) I; zdIs13 IV; armEx257. Show Description
zdIs13 [tph-1p::GFP] IV. armEx257 [dpy-7p::daf-16b::tagRFP + myo-2::GFP]. Pick animals with GFP+ pharynx to maintain. armEx257 rescues the daf-16(mu86) HSN undermigration phenotype. dpy-7p::daf-16b::tagRFP expression is localized to nuclei in hypodermal tissue during the comma, 1.5 and 2-fold stages, becoming cytoplasmic or perinuclear by the 3-fold stage and persisting into adulthood. Reference: Kennedy LM, et al. Cell Rep. 2013 Sep 12;4(5):996-1009.
|
|
| AH3437 |
C. elegans |
tln-1(zh117[gfp::tln-1]) I. Show Description
Wild-type morphology. Endogenous GFP reporter for tln-1. Reference: Walser M, et al. PLoS Genet. 2017 Jan 30;13(1):e1006592.
|
|
| AH5059 |
C. elegans |
let-23(zh131[FRT::let-23::FRT::GFP::LoxP::FLAG::let-23]) II. Show Description
CRISPR allele of endogenous let-23, which expresses let-23::GFP fusion protein and is susceptible for conditional knock-out via incorporated FRT sites with FLPase expression. Reference: Konietzka et al. 2019. Current Biology (accepted).
|
|
| ALF62 |
C. elegans |
bafIs62. Show Description
bafIs62 [lin-42p::GFP + unc-119(+)]. lin-42p::GFP reporter consists of 2 kb upstream of lin-42a isoform subcloned into modified pPD95.75 vector also carrying unc-119(+). Reference: Hochbaum D, et al. PLoS Genet. 2011 Jul;7(7):e1002179.
|
|
| ALF63 |
C. elegans |
unc-119(ed3) III; bafIs63. Show Description
bafIs63 [lin-42p(mut)::GFP + unc-119(+)]. lin-42p(mut)::GFP reporter consists of 2 kb upstream of lin-42a isoform subcloned into modified pPD95.75 vector also carrying unc-119(+); all potential DAF-12 binding sites have been mutated. Reference: Hochbaum D, et al. PLoS Genet. 2011 Jul;7(7):e1002179.
|
|
| ALF82 |
C. elegans |
unc-119(ed3) III; daf-12(rh61rh411) X; bafIs62. Show Description
bafIs62 [lin-42p::GFP + unc-119(+)]. lin-42p::GFP reporter consists of 2 kb upstream of lin-42a isoform subcloned into modified pPD95.75 vector also carrying unc-119(+). Array was crossed into strain ALF3 to create ALF82. Reference: Hochbaum D, et al. PLoS Genet. 2011 Jul;7(7):e1002179.
|
|
| AM1246 |
C. elegans |
rmIs126 X. Show Description
rmIs126 [unc-54p::Q0::YFP]. Diffuse distribution of Q0::YFP throughout the body-wall muscle cells. Worms maintain a soluble phenotype for the duration of their lifespan. [NOTE: This strain is a replacement for AM134, which was removed from distribution due to reports that it did not carry the correct transgene.]
|
|
| AMH151 |
C. elegans |
juIs76 II; daf-7(e1372) III. Show Description
juIs76 [unc-25p::GFP + lin-15(+)] II. Maintain at 15C. Temperature sensitive dauer constitutive. 100% dauers at 25C. Leaky at 20C. Crowds. Growth slow. GFP expression in GABAergic motor neurons.
|
|
| AMH50 |
C. elegans |
juIs76; bec-1(ok691) IV/nT1 [qIs51] (IV;V). Show Description
juIs76 [unc-25p::GFP + lin-15(+)] II. Heterozygotes are wild-type with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-pharyngeal GFP bec-1 homozygotes. Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain.
|
|
| AMJ565 |
C. elegans |
jamSi6 II; rde-4(ne301) III. Show Description
jamSi6 [nas-9p::rde-4(+)::rde-4 3' UTR + unc-119(+)] II. Enables RNAi silencing in body wall muscles in an otherwise rde-4(ne301) background. jamSi6 was integrated into ttTi5605 II in an EG4322 background using MosSCI. Unknown if unc-119(ed9) is still present or homozygous in background. An isolated inserted line was crossed into AMJ8 (juIs73 [unc-25p::GFP] III) to temporarily balance the endogenous rde-4 locus during the subsequent cross; resulting jamSi6 heterozygous males were crossed into WM49 (rde-4(ne301) III). rde-4(ne301) presumed to be homozygous in this strain due to crossing strategy and minimal recombination between rde-3 and juIs73. Reference: Raman P, et al. Nucleic Acids Res. 2017 Aug 21;45(14):8463-8473. doi: 10.1093/nar/gkx484. PMID: 28541563.
|
|
| AMJ912 |
C. elegans |
jamSi28 II; rde-4(ne301) III. Show Description
jamSi28 [myo-3p::rde-4(+)::rde-4 3' UTR + unc-119(+)] II. Enables RNAi silencing in body wall muscles in an otherwise rde-4(ne301) background. jamSi28 was integrated into ttTi5605 II in an EG4322 background using MosSCI. Unknown if unc-119(ed9) is still present or homozygous in background. An isolated inserted line was crossed into AMJ8 (juIs73 [unc-25p::GFP] III) to temporarily balance the endogenous rde-4 locus during the subsequent cross; resulting jamSi28 heterozygous males were crossed into WM49 (rde-4(ne301) III). rde-4(ne301) presumed to be homozygous in this strain due to crossing strategy and minimal recombination between rde-3 and juIs73. Reference: Raman P, et al. Nucleic Acids Res. 2017 Aug 21;45(14):8463-8473. doi: 10.1093/nar/gkx484. PMID: 28541563.
|
|
| AML175 |
C. elegans |
lite-1(ce314) X; wtfIs3. Show Description
wtfIs3 [rab-3p::NLS::GFP + rab-3p::NLS::tagRFP]. Worms expressing the calcium insensitive fluorescent proteins GFP and tagRFP in the nuclei of all neurons in a lite-1(ce314) background. Control strain for AML70. Reference: https://www.biorxiv.org/content/biorxiv/early/2018/10/17/445643.full.pdf
|
|
| AML18 |
C. elegans |
wtfIs3. Show Description
wtfIs3 [rab-3p::NLS::GFP + rab-3p::NLS::tagRFP]. RFP and GFP expression in the nuclei of all neurons. AML18 acts as a control for the calcium imaging strain AML14. Reference: Nguyen JP, et al. Proc Natl Acad Sci U S A. 2016 Feb 23;113(8):E1074-81.
|
|