OCF12 |
C. elegans |
lpin-1(ok2761) V/nT1 [qIs51] (IV;V). Show Description
Heterzygotes are wildtype and GFP+. lpin-1(ok2761) homozygotes die as L1 larvae. Homozygous nT1[qIs51] inviable.
|
|
VC2114 |
C. elegans |
lpin-1(ok2761) V/nT1 [qIs51] (IV;V). Show Description
H37A05.1. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok2761 homozygotes (probable early larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CTTACACACTCGGCGGTTTT. External right primer: TGTGTTAATTGGCACAGGGA. Internal left primer: TCAATTTCAACTGGATTCGATG. Internal right primer: AATCCTGCCACACTTTCAGG. Internal WT amplicon: 1279 bp. Deletion size: 518 bp. Deletion left flank: CTCGGTCTCAGCAGCGAGAACTGTAAGATC. Deletion right flank: GCTCTACGACAACCACATCGATTGCTCCTG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
OCF13 |
C. elegans |
lpin-1(ok2761)/sqt-3(sc8) unc-61(e228) V; ltIs37 IV; jjIs1092. Show Description
jjIs1092 [(pNUT1) npp-1::GFP + unc-119(+)]. ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. Heterozygotes are wildtype with GFP+ and mCherry+. lpin-1(ok2761) homozygotes die as L1 larvae. Also segregates Unc Rol.
|
|
ABR339 |
C. elegans |
lpin-1(wbm76[lpin-1::GFP]) V. Show Description
GFP tag inserted into endogenous lpin-1 locus. The strain was generated by using 5' attgttgctggcatcaaaaa crRNA for C-terminal lpin-1 editing and using dpy-10 editing as a co-conversion marker, followed by outcrossing twice to ABR lab stock of N2 to eliminate the dpy-10 co-conversion marker. Reference: Papsdorf et al, Nature Cell Biology, 2023, PMID 37127715. [NOTE: This strain was incorrectly named WBM1369 lpin-1(sta10[lpin-1::GFP]) in an earlier version of the paper.]
|
|
AG175 |
C. elegans |
unc-119(ed3) III; avEx122. Show Description
avEx122 [(pAG126) lpin-1p::GFP::lpin-1::lpin-1 3'UTR + unc-119(+)]. No GFP expression detected in germline.
|
|
AG176 |
C. elegans |
unc-119(ed3) III; avEx123. Show Description
avEx123 [lpin-1p::GFP::his-58::lpin-1 3'UTR + unc-119(+)]. No GFP expression detected in germline.
|
|