Strain Information

Name ABR339   View On Wormbase
Species C. elegans
Genotypelpin-1(wbm76[lpin-1::GFP]) V.
DescriptionGFP tag inserted into endogenous lpin-1 locus. The strain was generated by using 5' attgttgctggcatcaaaaa crRNA for C-terminal lpin-1 editing and using dpy-10 editing as a co-conversion marker, followed by outcrossing twice to ABR lab stock of N2 to eliminate the dpy-10 co-conversion marker. Reference: Papsdorf et al, Nature Cell Biology, 2023, PMID 37127715. [NOTE: This strain was incorrectly named WBM1369 lpin-1(sta10[lpin-1::GFP]) in an earlier version of the paper.]
MutagenCrispr/Cas9
Outcrossedx2
Made byCarlos G Silva-García/Katharina Papsdorf
Laboratory ABR
Reference Lipid droplets and peroxisomes are co-regulated to drive lifespan extension in response to mono-unsaturated fatty acids Katharina Papsdorf, Jason W Miklas, Amir Hosseini, Matias Cabruja, Christopher S Morrow, Marzia Savini, Yong Yu, Carlos G Silva-García, Nicole R Haseley, Luke Meraz Murphy, Pallas Yao, Elisa de Launoit, Scott J Dixon, Michael P Snyder, Meng C Wang, William B Mair, Anne Brunet Nature Cell Biology, 2023 May;25(5):672-684, doi: 10.1038/s41556-023-01136-6, PMID: 37127715, Epub 2023 May 1.
Sign in or register an account if you want to order this strain.