| AA120 |
C. elegans |
dhIs26. Show Description
dhIs26 [daf-12a::GFP + lin-15(+)]. DAF-12::GFP localized primarily in nucleus, except during mitosis. Expressed widely in most cells including tissues modified for dauer formation or by stage from embryo to adult, but most elevated and widespread during L2.
|
|
| AA277 |
C. elegans |
lin-15B&lin-15A(n765) X; dhIs64. Show Description
dhIs64 [daf-9p::daf-9::GFP + lin-15(+)].
|
|
| AA278 |
C. elegans |
dhIs59. Show Description
dhIs59 [Topo::daf-9::GFP + lin-15(+)]. Perinuclear expression in a ventral pair of bilateral neurons identified as the IL1Vs or URAVs in the anterior ganglia. By mid-L2, expression in the cytoplasm of the hypodermis, the syncitial epidermis, but absent from midline, epidermal seam cells. Levels peak around the L2 molt and diminish during L4. In some cases, transient expression seen in the L3 vulval blast cells. Also expressed within the hermaphrodite spermatheca starting in late L4 larvae and continuing eve in old adults. In males, expression in IL1V/URAVs and hypodermis but not somatic gonad. In dauer larvae, strong expression in IL1V/URAV and specifically extends into axonal but not dendritic processes. In post-dauer stages, expression in a pattern similar to reproductively growing animals, except expression is absent in the hypodermis. Grow at 20C. May still contain lin-15(n765) mutation in the background.
|
|
| AA790 |
C. elegans |
lin-15B&lin-15A(n765) X; dhEx343. Show Description
dhEx343 [din-1p::din-1E::GFP + lin-15(+)]. Pick GFP+ to maintain. Animals with the array are GFP+ and non-Muv. Animals which have lost the array are Muv and non-GFP. din-1s::GFP is detected in hypodermis, seam, intestine, and somatic gonad including the distal tip cells. din-1s is also expressed in neurons, vulval precursors, body wall muscle, pharynx, and all tissues with heterochronic phenotypes or remodeled during dauer. Expression is first detected in a few nuclei by the comma stage of embryogenesis. By hatching, din-1s was widely expressed, albeit weakly. Overall expression in most tissues is detected at various levels into adult and in dauer larvae. Animals with the array are GFP+ and non-Muv. Animals which have lost the array are Muv and non-GFP. din-1p::din-1E::GFP was produced by cloning into Fire Lab vector L3781.
|
|
| AA85 |
C. elegans |
daf-12(rh285) X. Show Description
Strong heterochronic phenotypes in seam, somatic gonad, and intestine. Weakly daf-c at 15C. Class IV allele.
|
|
| ABR1 |
C. elegans |
pha-1(e2123) III; staEx1. Show Description
staEx1 [T20F7.6p + pha-1(+)]. Empty vector control strain. Maintain at 25 degrees. Superficially wild-type. Reference: Greer EL et al Curr Biol 2007 Oct 9;17(19):1646-56.
|
|
| ABR156 |
C. briggsae |
Cbr-she-1(v35) IV; mfIs42. Show Description
mfIs42 [Cel-sid-2(+) + Cel-myo-2::dsRed]. Maintain at 15C. Feminization is partially-penetrant at 15C; most hermaphrodites are somewhat self-fertile and can lay small broods. Can be maintained by crossing with male siblings. Feminized C. briggsae strain made susceptible to RNAi knock-down by feeding dsRNA due to the transgenic expression of C. elegans SID-2. Generated by crossing parental strains JU1018 with RE665. Reference: Booth LN, eLife 2019 Jul 8;8:e46418. PMID: 31282863.
|
|
| ABR161 |
C. elegans |
hjIs37; ldrIs1. Show Description
hjIs37 [vha-6p::mRFP-PTS1 + Cbr-unc-119(+)]. ldrIs1 [dhs-3p::dhs-3::GFP + unc-76(+)]. mRFP targeted to peroxisomes in intestinal cells. dhs-3::GFP is expressed mainly in intestinal cells and localized to intestinal lipid droplets. Derived by crossing parental strains VS10 and LIU1 and outcrossing six times to ABR lab stock of N2. Reference: Papsdorf K, et al. Nat Cell Biol. 2023 May;25(5):672-684. doi: 10.1038/s41556-023-01136-6. 2023. PMID 37127715.
|
|
| ABR225 |
C. elegans |
acd-1(sta6) delm-2(ok1822) I; delm-1(ok1266) IV. Show Description
acd-1 and delm-2 are tandem paralogs. This double mutant was created by CRISPR-engineered deletion of acd-1 in a delm-2(ok1822) background (parental strain RB1523). acd-1(sta6) is predicted to be a null allele (~200bp indel causing frameshift in exon 4). This triple mutant strain was made by crossing the acd-1(sta6) delm-2(ok1822) double mutant with delm-1(ok1226) parental strain RB1177.
|
|
| ABR339 |
C. elegans |
lpin-1(wbm76[lpin-1::GFP]) V. Show Description
GFP tag inserted into endogenous lpin-1 locus. The strain was generated by using 5' attgttgctggcatcaaaaa crRNA for C-terminal lpin-1 editing and using dpy-10 editing as a co-conversion marker, followed by outcrossing twice to ABR lab stock of N2 to eliminate the dpy-10 co-conversion marker. Reference: Papsdorf et al, Nature Cell Biology, 2023, PMID 37127715. [NOTE: This strain was incorrectly named WBM1369 lpin-1(sta10[lpin-1::GFP]) in an earlier version of the paper.]
|
|
| ABR4 |
C. elegans |
pha-1(e2123) III; staEx4. Show Description
staEx4 [T20F7.6p(R81Q)::T20F7.6 + pha-1(+)]. Constitutively active T20f7.6 promoter construct (CA3). Maintain at 25 degrees. Superficially wild-type with increased lifespan and stress resistance. Reference: Greer EL et al Curr Biol 2007 Oct 9;17(19):1646-56.
|
|
| ABR5 |
C. elegans |
unc-119(ed3) III; staIs1. Show Description
staIs1 [pie-1p::GFP + unc-119(+)]. Superficially wild-type. Maintain under normal conditions. Reference: This strain was used as the empty vector control in Greer EL et al Nature 2010 doi: 10.1038/nature09195.
|
|
| ABR7 |
C. elegans |
unc-119(ed3) III; staIs2. Show Description
staIs2 [pie-1p::rbr-2::GFP + unc-119(+)]. Extended longevity. Maintain under normal conditions. Reference: This strain was used as LC Ppie-1::rbr-2::GFP (#3) in Greer EL et al Nature 2010 doi: 10.1038/nature09195.
|
|
| ABR9 |
C. elegans |
set-2(ok952) III; rbr-2(tm1231) IV. Show Description
Reduced lifespan. Maintain under normal conditions. The parental rbr-2 strain was outcrossed 6x and the parental set-2 strain was outcrossed 2x. Reference: Greer EL et al Nature (2010) doi: 10.1038/nature09195.
|
|
| AC365 |
C. elegans |
sao-1(ok3335) V. Show Description
Derived by outcrossing parental strain RB2429 six times to N2, followed by recombining flanking chromosome to the right and left by recombining on, and then off rol-4(sc8) and unc-76(e911). Reference: Hale VA, et al. Genetics. 2012 Mar; 190(3): 1043-1057.
|
|
| AD265 |
C. elegans |
nnIs2. Show Description
nnIs2 [pie-1p::GFP::chs-1 + unc-119(+)].
|
|
| AD266 |
C. elegans |
egg-4(tm1508) egg-5(ok1781) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP tm1508 ok1781 homozygotes (maternal sterile). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Reference: Parry JM, et al 2009 Current Biology 19(20):1752-7.
|
|
| AD271 |
C. elegans |
spe-38(eb44) I; him-5(e1490) V; asEx78. Show Description
asEx78 [spe-38p::spe-38(cDNA)::spe-38 3'UTR + myo-3p::GFP]. Pick GFP+ to maintain. GFP+ worms are fertile; animals that have lost the array are sterile.
|
|
| AD281 |
C. elegans |
spe-45(as38) IV; him-5(e1490) V. Show Description
Him. Temperature-sensitive sterile. Small brood size even at permissive temperatures; pick fertile animals and maintain at 15C. Worms lacking spe-45 function produce morphologically normal and motile sperm that cannot fuse with oocytes despite direct contact in the reproductive tract. spe-45 hermaphrodites and males are subfertile at 16C and sterile at 25C. Reference: Singaravelu G, et al. Current Biology 2015. http://dx.doi.org/10.1016/j.cub.2015.10.055
|
|
| AD292 |
C. elegans |
spe-51(as39) IV; him-5(e1490) V; asEx95. Show Description
asEx95 [T22B11.1(genomic) + myo-3p::GFP]. Pick GFP+ animals to maintain. as39 is a non-conditional allele of spe-51. Mutant hermaphrodites and males are severely subfertile due to a sperm defect. The extrachromosomal array asEx95 effectively rescues the fertility defect. Him. Reference: Mei X, et al. Curr Biol. 2023 Jul 3;S0960-9822(23)00780-7. doi: 10.1016/j.cub.2023.06.029. PMID: 37453427.
|
|
| AD294 |
C. elegans |
cylc-2(mon2[cylc-2::mNG::3xFLAG) I; him-5(e1490) V. Show Description
Endogenous cycl-2 locus tagged with mNeonGreen (mNG). Green fluorescence in sperm. Him. Reference: Krauchunas AR, et al. (2020). C. elegans CYLC-2 localizes to sperm. microPublication Biology. 10.17912/micropub.biology.000314.
|
|
| AD296 |
C. elegans |
spe-51(syb2737[spe-51::mNeonGreen]) IV; him-5(e1490) V. Show Description
mNeonGreen tag inserted into the endogenous spe-51 locus. Him. Reference: Mei X, et al. Curr Biol. 2023 Jul 3;S0960-9822(23)00780-7. doi: 10.1016/j.cub.2023.06.029. PMID: 37453427.
|
|
| AD309 |
C. elegans |
spe-21(syb4299) III; asEx98. Show Description
asEx98 [spe-21(+) + myo-3::GFP]. Pick GFP+ animals to maintain. syb(4299) is a non-conditional allele of spe-21. Mutant hermaphrodites and males are severly subfertile. Array carries a fragment (PCR product) of R13F6.5 containing a wild-type copy spe-21(+). spe-21/R13F6.5 formerly known as dhhc-5. The extrachromosomal array effectively rescues the fertility defect. Reference: Suryanarayanan S, et al. bioRxiv 2025.03.03.641263; doi: https://doi.org/10.1101/2025.03.03.641263.
|
|
| AD316 |
C. elegans |
spe-21(syb4179[spe-21::mNG]) III. Show Description
mNeonGreen tag inserted at the C-terminus of the endogenous spe-21 locus by CRISPR. Expression in the membranous organelles of sperm. Reference: Suryanarayanan S, et al. bioRxiv 2025.03.03.641263; doi: https://doi.org/10.1101/2025.03.03.641263.
|
|
| AD319 |
C. elegans |
spe-38(syb6556[spe-38::wrmScarlet-I]) I; him-5(e1490) V. Show Description
wrmScarlet-I tag inserted into endogenous spe-38 locus. Him. wrmScarlet-I expression labels membranous organelles (MOs) in the sperm. Reference: Zuo Y, et al. Biomolecules. 2023; 13(4):623. https://doi.org/10.3390/biom13040623
|
|
| ADS1002 |
C. elegans |
aeaIs10. Show Description
aeaIs10 [rgef-1p::GCaMP6s::3xNLS + lin-15(+)]. Worms express GCaMP6s in all neuronal nuclei. Pan-neuronal imaging strain; suitable for rapid whole-brain imaging due to brightness, good signal to noise ratio, and relative resistance to photo-bleaching. Reference: Susoy V, et al. Cell. 2021 Sep 30;184(20):5122-5137.e17. PMID: 34534446
|
|
| ADS707 |
C. elegans |
unc-13(s69) I; aeaIs8; hpIs728. Show Description
aeaIs8 [ift-20p::GCaMP6s::3xNLS + lin-15(+)]. hpIs728 [gpc-1p::wCherry + lin-15(+)]. Unc. Nuclear-localized GCaMP6s expressed in ciliated sensory neurons. Cytoplasmic wCherry expression in a subset of neurons. Derived by crossing EG9631 (unc-13) hermaphrodites with ZM10104 (aeaIs8; hpIs728) heterozygous males. Reference: Lin A, et al. bioRxiv 2022.05.27.493772; doi: https://doi.org/10.1101/2022.05.27.493772.
|
|
| AF13(4) |
Oscheius akosreti |
Oscheius akosreti wild isolate. Show Description
Isolated in Memorial Park in Madison, WI. No hermaphrodites. Lots of SDS resistant dauers. Can survive between 15-28C, but grows very slowly at 15C.
|
|
| AF25 |
Unknown species |
Show Description
|
|
| AF5 |
Oscheius sp. |
Oscheius sp. wild isolate Show Description
Isolated in Towers Hill State Park in WI. Males are rare. No SDS resistant dauers. Animals are osmosensitive, can be dried competely and recover in water. Rhabditidae. Previously known as Rhabditis sp.
|
|
| AFS205 |
C. elegans |
zen-4(cle5) IV. Show Description
Temperature-sensitive embryonic-lethal mutant. Maintain at 15C. Shift L4s to 25C overnight to observe mutant phenotype of embryos produced by adults. Mutants lack a central spindle during early embryonic mitosis and exhibits a late cytokinesis defect (cleavage furrows regress after ingressing in nearly to the center of dividing embryonic cells). This strain can be used for CRISPR-Cas9 co-conversion. There is a causal mis-sense mutation present in zen-4(cle5), GAC to AAC (D520N), and one silent mutation, GCA to GCT at codon 519, that introduces an AluI site for RFLP analysis. A previous deposited version of this strain, zen-4(ok153), possessed two mis-sense mutations: GAC to AAC (D520N) and GAT to AAT (D735N). Reference: Farboud B, et al. Genetics Early online November 30, 2018; https://doi.org/10.1534/genetics.118.301775.
|
|
| AFS222 |
C. elegans |
zen-4(cle10) IV. Show Description
Temperature-sensitive embryonic-lethal mutant. Maintain at 15C. Shift L4s to 25C overnight to observe mutant phenotype of embryos produced by adults. Mutants lack a central spindle during early embryonic mitosis and exhibits a late cytokinesis defect (cleavage furrows regress after ingressing in nearly to the center of dividing embryonic cells). This strain can be used for CRISPR-Cas9 co-conversion. There is a causal mis-sense mutation present in zen-4(cle10), GAC to AAC (D520N), and two silent mutations. One silent mutation is a CGA to CGG mutation at codon 523 that creates a recognition site for a Cas9 guide RNA, in order to use zen-4(cle10ts) as a CRISPR/Cas9 co-conversion marker. The other silent mutation is a GCA to GCT mutation at codon 519 that introduces an AluI site for RFLP analysis. Reference: Farboud B, et al. Genetics Early online November 30, 2018; https://doi.org/10.1534/genetics.118.301775.
|
|
| AG151 |
C. elegans |
cdc-25.1(nr2036)/dpy-5(e61) unc-13(e450) I. Show Description
Heterozygotes are WT and segregate WT, DpyUncs and adult steriles. Original deletion from Axys Pharmaceuticals.
|
|
| AG152 |
C. elegans |
unc-85(e1414) bli-2(e768) dpy-10(e128) II. Show Description
Unc and Dpy. Not Blistered: dpy-10 suppresses the appearance of the blisters.
|
|
| AG165 |
C. elegans |
san-1(av31) unc-13(e450) I. Show Description
Unc. Reduced brood size. Larval lethal, larval arrest. Steriles. Bursts at vulva. Can be maintained as a homozygote.
|
|
| AG166 |
C. elegans |
mdf-2(av16) unc-17(e245) IV. Show Description
Reduced brood size. Reduced hatching. Slow growth. Larval lethal. Larval arrest. Bursts at vulva. Suppresses the mat-3 one-cell arrest at 25C.
|
|
| AG168 |
C. elegans |
fzy-1(av15) unc-4(e120) II. Show Description
Unc. Gain-of-function allele of fzy-1.
|
|
| AG175 |
C. elegans |
unc-119(ed3) III; avEx122. Show Description
avEx122 [(pAG126) lpin-1p::GFP::lpin-1::lpin-1 3'UTR + unc-119(+)]. No GFP expression detected in germline.
|
|
| AG226 |
C. elegans |
rol-6(e187) unc-4 (e120)/mnC1 [dpy-10(e128) unc-52(e444) nIs190 let-?] II; him-8(e1489) IV. Show Description
nIs190 [myo-2::GFP]. Him. Heterozygotes are wild-type GFP+ and segregate WT GFP+ heterozygotes, Rol Uncs, dead embryos, and males. nIs190 [myo-2::GFP] integrated in or near mnC1. Approx 0.5% recombination seen between nIs190 and mnC1. Fails to complemement all markers on mnC1.
|
|
| AG247 |
C. elegans |
tyms-1(tm2429) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Homozygous lethal deletion balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP+, arrested hT2 aneuploids, and non-GFP tm2429 homozygotes (embryonic lethal). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP+ and check for correct segregation of progeny to maintain. Reference: Jaramillo-Lambert A, et al. G3 (2015).
|
|
| AG248 |
C. elegans |
mus-101(tm1761) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Homozygous lethal deletion balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP+, arrested hT2 aneuploids, and non-GFP tm1761 homozygotes (embryonic lethal). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP+ and check for correct segregation of progeny to maintain. Reference: Jaramillo-Lambert A, et al. G3 (2015).
|
|
| AGD1032 |
C. elegans |
glp-1(e2141) III; xzEx1. Show Description
xzEx1 [unc-54p::Dendra2]. Maintain at 15C; sterile at 25C. Pick animals with green fluorescence in body wall muscle to maintain. Reference: Vilchez D, et al. Nature. 2012 Sep 13;489(7415):263-8.
|
|
| AGD1033 |
C. elegans |
glp-1(e2141) III; xzEx3. Show Description
xzEx3 [unc-54p::UbG76V::Dendra2]. Maintain at 15C; sterile at 25C. Pick animals with green fluorescence in body wall muscle to maintain. Reference: Vilchez D, et al. Nature. 2012 Sep 13;489(7415):263-8.
|
|
| AGD1047 |
C. elegans |
glp-1(e2141) III; uthEx649. Show Description
uthEx649 [rpn-6p::tdTomato + rol-6(su1006)]. Temperature-sensitive. Maintain at 15C; sterile at 25C. Rollers. Pick rollers to maintain array. Reference: Vilchez D, et al. Nature. 2012 Sep 13;489(7415):263-8.
|
|
| AGD1048 |
C. elegans |
daf-16(mu86) I; glp-1(e2141) III; uthEx649. Show Description
uthEx649 [rpn-6p::tdTomato + rol-6(su1006)]. Temperature-sensitive. Maintain at 15C; sterile at 25C. Rollers. Pick rollers to maintain array. Reference: Vilchez D, et al. Nature. 2012 Sep 13;489(7415):263-8.
|
|
| AGD418 |
C. elegans |
uthIs205. Show Description
uthIs205 [crtc-1p::crtc-1::RFP::unc-54 3'UTR + rol-6(su1006)].
|
|
| AGD597 |
C. elegans |
uthEx556. Show Description
uthEx556 [sur-5p::rpn-6 + myo-3p::GFP]. Pick animals with GFP expression in body wall muscle to maintain. Reference: Vilchez D, et al. Nature. 2012 Sep 13;489(7415):263-8.
|
|
| AGD598 |
C. elegans |
uthEx557. Show Description
uthEx557 [sur-5p::rpn-6 + myo-3p::GFP]. Pick animals with GFP expression in body wall muscle to maintain. Reference: Vilchez D, et al. Nature. 2012 Sep 13;489(7415):263-8.
|
|
| AGD614 |
C. elegans |
uthEx633. Show Description
uthEx633 [myo-3p::GFP]. Pick animals with GFP expression in body wall muscle to maintain. Reference: Vilchez D, et al. Nature. 2012 Sep 13;489(7415):263-8.
|
|
| AGD710 |
C. elegans |
uthIs235. Show Description
uthIs235 [sur-5p::hsf-1::unc-54 3'UTR + myo-2p::tdTomato::unc-54 3' UTR]. Long-lived, thermotolerant. Small brood size. Reference: Baird NA, et al. Science. 2014 Oct 17;346(6207):360-3.
|
|