| BC4849 |
C. elegans |
dpy-17(e164) let-767(s2819) ncl-1(e1865) unc-32(e189) III; sDp3 (III;f). Show Description
Animals with the duplication are Unc. See also WBPaper00002901.
|
|
| ABR339 |
C. elegans |
lpin-1(wbm76[lpin-1::GFP]) V. Show Description
GFP tag inserted into endogenous lpin-1 locus. The strain was generated by using 5' attgttgctggcatcaaaaa crRNA for C-terminal lpin-1 editing and using dpy-10 editing as a co-conversion marker, followed by outcrossing twice to ABR lab stock of N2 to eliminate the dpy-10 co-conversion marker. Reference: Papsdorf et al, Nature Cell Biology, 2023, PMID 37127715. [NOTE: This strain was incorrectly named WBM1369 lpin-1(sta10[lpin-1::GFP]) in an earlier version of the paper.]
|
|
| AD226 |
C. elegans |
egg-3(tm1191)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP+ (heterozygotes), Dpy bright GFP+ (mIn1 homozygotes), and non-GFP tm1191 homozygotes. Pick WT dim GFP and check for correct segregation of progeny to maintain.
|
|
| AG152 |
C. elegans |
unc-85(e1414) bli-2(e768) dpy-10(e128) II. Show Description
Unc and Dpy. Not Blistered: dpy-10 suppresses the appearance of the blisters.
|
|
| AG226 |
C. elegans |
rol-6(e187) unc-4 (e120)/mnC1 [dpy-10(e128) unc-52(e444) nIs190 let-?] II; him-8(e1489) IV. Show Description
nIs190 [myo-2::GFP]. Him. Heterozygotes are wild-type GFP+ and segregate WT GFP+ heterozygotes, Rol Uncs, dead embryos, and males. nIs190 [myo-2::GFP] integrated in or near mnC1. Approx 0.5% recombination seen between nIs190 and mnC1. Fails to complemement all markers on mnC1.
|
|
| AGD1101 |
C. elegans |
uthIs372. Show Description
uthIs372 [sur-5p::pat-10::unc-54 3'UTR + myo-2p::tdTomato::unc-54 3' UTR]. Long-lived, thermotolerant. Reference: Baird NA, et al. Science. 2014 Oct 17;346(6207):360-3.
|
|
| AN170 |
C. elegans |
aff-1(ty4) unc-4(e120)/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
Heterozygotes are WT and segregate WT (heterozygotes), Unc-4 worms which are strong Egl (ty4 homozygotes), and paralyzed Dpy Uncs (mnC1 homozygotes).
|
|
| AV106 |
C. elegans |
spo-11(ok79) IV/nT1 [unc-?(n754) let-?] (IV;V). Show Description
Heterozygotes are Unc and segregate Uncs (heterozygotes), non-Unc spo-11 homozygotes, and dead eggs (nT1 homozygotes). spo-11 homozygotes produce an average of ~200 fertilized eggs but only about 0.1 progeny survive to adulthood. When mated to N2 males, spo-11 homozygotes will produce at least 5-10 cross progeny.
|
|
| AV307 |
C. elegans |
syp-1(me17) V/nT1 [unc-?(n754) let-? qIs50] (IV;V). Show Description
Balanced heterozygotes are GFP+ Unc and segregate GFP+ Unc (heterozygotes), non-GFP non-Unc syp-1(me17) homozygotes, and dead eggs (nT1 homozygotes). syp-1(me17) homozygotes produce 95% dead embryos and 38% males. Cytologically they lack chiasmata in diakinesis-stage oocytes, exhibit persistent polarized nuclear organization during earlier meiotic prophase, lack synaptonemal complexes, and exhibit unstable pairing of homologous chromosomes. qIs50 is an insertion of ccEx9747 with markers: myo-2::GFP expressed brightly in the pharynx throughout development, pes-10::GFP expressed in embryos, and a gut promoter (F22B7.9) driving GFP in the intestine.
|
|
| AV308 |
C. elegans |
him-14(it21)/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
Heterozygotes are wild-type and segregate wild-type heterozygotes, DpyUncs (mnC1 homozygotes), and him-14 homozygotes that produce >95% dead embryos and 45% males. Among these surviving progeny, cytologically they have 12 univalents in diakinesis-stage oocytes owing to a failure to form crossovers during meiosis.
|
|
| AV828 |
C. elegans |
nbs-1(me102) meIs8/mIn1 [mIs14 dpy-10(e128)] II. Show Description
meIs8 [pie-1p::GFP::cosa-1 + unc-119(+)] II. Transgene contains a combination of cDNA and genomic sequences of cosa-1 including 212 bp of 3'UTR. GFP is expressed in the adult germline as 6 bright foci per nucleus (one per chromosome pair) from late pachytene through diplotene stages. Homozygous sterile mutation balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP me103 homozygotes (sterile adult). Pick WT dim GFP and check for correct segregation of progeny to maintain. nbs-1(me103) homozygotes have frayed and aggregated chromosomes at diakinesis of meiosis I. References: Girard C, et al. Proc Natl Acad Sci U S A. 2018 May 8;115(19):E4443-E4452. Yokoo R, et al. Cell. 2012 Mar 30;149(1):75-87.
|
|
| AV860 |
C. elegans |
nbs-1(me103)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
Homozygous sterile mutation balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP me103 homozygotes (sterile adult). Pick WT dim GFP and check for correct segregation of progeny to maintain. nbs-1(me103) homozygotes have frayed and aggregated chromosomes at diakinesis of meiosis I. Reference: Girard C, et al. Proc Natl Acad Sci U S A. 2018 May 8;115(19):E4443-E4452.
|
|
| AX2061 |
C. elegans |
dbEx813. Show Description
dbEx813 [gcy-37p::cGi500]. Pick GFP+ animals to maintain. The cGi500 cGMP sensor is expressed in the oxygen-sensing AQR, PQR, and URX neurons. Reference: Couto A, et al. Proc Natl Acad Sci U S A. 2013 Aug 27;110(35):E3301-10.
|
|
| BA1093 |
C. elegans |
snf-10(hc194) V. Show Description
Y32F6A.2 No visible phenotype in hermaphrodites. Primers: outer HES 22/228 and inner HES 229/230.
|
|
| BA585 |
C. elegans |
spe-10(hc104) unc-76(e911) V. Show Description
Unc. Temperature sensitive, maintain at 16C. Average progeny: at 16C= 7 +/- 5; at 25C= 0.1 +/- .1.
|
|
| BA590 |
C. elegans |
spe-10(hc104) dpy-11(e224) V. Show Description
Dpy. Temperature sensitive, maintain at 16C. Average progeny at 16C= 7 +/- 5. At 25C, average progeny = 0.1 =/- .1.
|
|
| BA744 |
C. elegans |
spe-10(hc104) V. Show Description
Temperature sensitive, maintain at 15C. Average progeny at 16C is 7 +/- 5. Average progeny at 25C is 0.1 +/- .1.
|
|
| BA782 |
C. elegans |
spe-10(hc104) him-5(e1490) V. Show Description
Temperature sensitive, maintain at 16C. Segregates males. Average progeny at 16C is 7 +/- 5. Average progeny at 25C is 0.1 +/- .1.
|
|
| BE8 |
C. elegans |
sqt-3(sc8) V. Show Description
Adults and L4 animals roll left. Recessive. M-MATING++ 1-10%WT. PKA rol-4.
|
|
| BJS78 |
C. elegans |
smc-5(sbj3)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
Homozygous viable mutation balanced by GFP- and dpy-10-marked inversion. Heterozygotes are wild-type with pharyngeal GFP signal, and segregate wild-type GFP+, Dpy bright GFP+ (mIn1 homozygotes), and non-GFP sbj3 homozygotes. Pick wild-type GFP+ to maintain. sbj3 homozygotes are morphologically wild-type but show reduction in viable progeny. Reference: Wolters S, et al. Genetics. 2014 Apr;196(4):985-99.
|
|
| BJS79 |
C. elegans |
smc-5(sbj2)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
Homozygous viable mutation balanced by GFP- and dpy-10-marked inversion. Heterozygotes are wild-type with pharyngeal GFP signal, and segregate wild-type GFP+, Dpy bright GFP+ (mIn1 homozygotes), and non-GFP sbj3 homozygotes. Pick wild-type GFP+ to maintain. sbj3 homozygotes are morphologically wild-type but show reduction in viable progeny. Reference: Wolters S, et al. Genetics. 2014 Apr;196(4):985-99.
|
|
| BN1007 |
C. elegans |
+/mT1 [umnIs34] II; baf-1(bq24[G>F>P::baf-1[G12T]])/mT1 [dpy-10(e128)] III. Show Description
umnIs34 [myo-2p::GFP + NeoR, III: 8856215 (intergenic)] II. Heterozygotes are wild-type GFP+ (pharynx), and segregate wild-type GFP+ (pharynx), Maternal effect lethal (Mel) non-GFP, sterile Dpy GFP+ (pharynx) mT1 homozygotes, and large numbers of arrested aneuploid embryos. Maintain by picking wild-type GFP+ and check for correct segregation of progeny to maintain. GFP tag inserted into N-terminus of endogenous baf-1(G12T) using CRISPR/Cas9. FRT sites in GFP introns 1 & 2 (indicated by ">" symbols in genotype) enable FLP-mediated conditional gene knockout. BAF-1(G12T) is a model for Nestor-Guillermo Progeria Syndrome. Reference: Romero-Bueno R, et al. EMBO J. 43(22): 5718-5746. doi: 10.1038/s44318-024-00261-8. PMID: 39367234.
|
|
| BN3 |
C. elegans |
vrk-1(ok1181)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
F28B12.3. Homozygous sterile deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok1181 homozygotes (sterile adult). Pick WT dim GFP and check for correct segregation of progeny to maintain. Klerkx et al, Dev Biol. 2009 335:12-21.
|
|
| BN30 |
C. elegans |
npp-15(ok1954) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Heterozygotes are WT and GFP+. ok1954 homozygotes arrest as larvae. Pick GFP+ heterozygotes to maintain. qIs48 is an insertion of ccEx9747 with markers: myo-2::GFP expressed brightly in the pharynx throughout development, pes-10::GFP expressed in embryos, and a gut promoter driving GFP in the intestine, and is homozygous lethal. Reference: Rodenas E, et al. Mol Biol Cell. 2012 Mar;23(5):930-44.
|
|
| BN40 |
C. elegans |
npp-5(tm3039)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
Homozygous deletion chromosome balanced by GFP- and dpy-10-marked inversion. tm3039 homozygotes are viable but produce progengy that are primarily Lva or Lvl. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP tm3039 homozygotes. Pick WT dim GFP and check for correct segregation of progeny to maintain. Reference: Rodenas E, et al. Mol Biol Cell. 2012 Mar;23(5):930-44.
|
|
| BN426 |
C. elegans |
mel-28(bq5[GFP::mel-28]) III. Show Description
Strain ubiquitously expresses GFP::MEL-28 from the endogenous mel-28 locus. Transgene was inserted into parental strain N2 using CRISPR/Cas9 and co-conversion of dpy-10. Outcrossed twice to N2 to remove dpy-10. Reference: Gomez-Saldivar G, et al. PLoS Genet. 2016 Jun 24;12(6):e1006131.
|
|
| BN452 |
C. elegans |
bqSi189 II; mel-28(bq5[GFP::mel-28]) III. Show Description
bqSi189 [lmn-1p::mCherry::his-58 + unc-119(+)] II. Strain ubiquitously expresses GFP::MEL-28 from the endogenous mel-28 locus. Transgene was inserted into parental strain N2 using CRISPR/Cas9 and co-conversion of dpy-10. Outcrossed twice to N2 to remove dpy-10. bqSi189 is a single-copy MosSCI insertion into ttTi5605 derived from injection of pBN13. Derived from parental strains BN189 and BN426. Reference: Gomez-Saldivar G, et al. PLoS Genet. 2016 Jun 24;12(6):e1006131.
|
|
| BN53 |
C. elegans |
vrk-1(ok1181)/mIn1 [mIs14 dpy-10(e128)] II; vrIs13. Show Description
vrIs13 [vrk-1p::VRK-1:GFP:VRK3UTR + unc-119(+)]. F28B12.3. Homozygous sterile deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok1181 homozygotes (sterile adult). Pick WT dim GFP and check for correct segregation of progeny to maintain. Klerkx et al, Dev Biol. 2009 335:12-21.
|
|
| BN69 |
C. elegans |
npp-5(tm3039)/mIn1 [mIs14 dpy-10(e128)] II; bqIs51 ltIs37 IV. Show Description
bqIs51 [pie-1p::GFP::npp-5 + unc-119(+)] IV. ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. Expresses GFP::NPP-5 and mCherry in the germ line. Homozygous deletion chromosome balanced by GFP- and dpy-10-marked inversion. tm3039 homozygotes are viable but produce progengy that are primarily Lva or Lvl; bqIs51 transgene rescues the npp-5(tm3039) phenotype. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP tm3039 homozygotes. Pick WT with dim GFP in the pharynx and check for correct segregation of progeny to maintain. Reference: Rodenas E, et al. Mol Biol Cell. 2012 Mar;23(5):930-44.
|
|
| BN85 |
C. elegans |
npp-5(ok1966)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
Homozygous deletion chromosome balanced by GFP- and dpy-10-marked inversion. ok1966 homozygotes are viable but produce progengy that are primarily Lva or Lvl. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP tm3039 homozygotes. Pick WT dim GFP and check for correct segregation of progeny to maintain. Reference: Rodenas E, et al. Mol Biol Cell. 2012 Mar;23(5):930-44.
|
|
| BP601 |
C. elegans |
aff-1(tm2214)/mIn1 [dpy-10(e128) mIs14] II. Show Description
Homozygous sterile mutation balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and few GFP- tm2214 homozygotes animals which give very small brood size and hence can only be slowly propagated (see BP600 for detailed description for homozygote tm2214 phenotypes). Pick WT dim GFP and check for correct segregation of progeny to maintain.
|
|
| BP610 |
C. elegans |
eff-1(ok1021) aff-1(tm2214)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
Heterozygotes are WT with relatively dim pharyngeal GFP signal. Segregates Dpy with bright GFP (mIn1 homozygotes). Segregates very few escapers that are non-GFP (ok1021 tm2214 homozygotes).
|
|
| BS3493 |
C. elegans |
gld-3(ok308)/mIn1 [dpy-10(e128) mIs14] II. Show Description
Homozygous sterile mutation balanced by GFP- and dpy-10-marked inversion. Heterozygotes are wild-type with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok308 homozygotes (mostly sterile or Mel, but can be slowly propagated at 20C). Pick WT dim GFP and check for correct segregation of progeny to maintain.
|
|
| BS5351 |
C. elegans |
nos-2(ok230) nos-1(gv5)/mIn1 [dpy-10(e128) mIs14] II. Show Description
Homozygous sterile mutation balanced by GFP- and dpy-10-marked inversion. Heterozygotes are wild-type with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP nos-2 nos-1 homozygotes (segregate many dead embryos). Pick wild-type dim GFP and check for correct segregation of progeny to maintain. Reference: Hansen D, et al. Development. 2004 Jan;131(1):93-104.
|
|
| BW315 |
C. elegans |
mig-10(ct41) III. Show Description
Withered tail and Egl. Adults shorter than WT. Embryonic cell migrations affected: ALM and HSN with high penetrance, CAN with moderate penetrance. All misplaced nuclei at positions indicating incomplete migration.
|
|
| BW506 |
C. elegans |
ceh-10(ct78) III. Show Description
Withered tail. Adults shorter than WT. Embryonic cell migrations affected: CAN migration with high penetrance. Previously called mig-11.
|
|
| BW538 |
C. elegans |
unc-13(e1091) lin-10(e1438) I. Show Description
Unc and Vul.
|
|
| BW54 |
C. elegans |
ct350 II. Show Description
Maintain at 15C. Temperature sensitive embryonic lethal. Sterile at 25C. Congenic strain, N2 and Bergerac BE. This allele should NOT be assumed to define a gene to which someone gave the name zyg-12. This name should not be used unless someone finds a non-complementing Bristol mutation. There is no evidence at present that the ts results from a single gene defect. Has been backcrossed >6 times to Bristol strains and should only contain Bergerac DNA in the unc-85 to dpy-10 region.
|
|
| BW589 |
C. elegans |
lin-10(e1438) unc-29(e1072) I. Show Description
Vul and Unc.
|
|
| BW635 |
C. elegans |
lin-10(e1438) daf-8(e1393) I. Show Description
Maintain at 15C. Vulvaless. Temperature-sensitive constitutive dauer (Daf-c) at 25C.
|
|
| CB1001 |
C. elegans |
flu-3(e1001) II. Show Description
Increased gut fluorescence, purple. M-MATING++ 1-10%WT. Recessive.
|
|
| CB1002 |
C. elegans |
flu-1(e1002) V. Show Description
Increased gut fluorescence, bluish purple. M-MATING++ 1-10%WT. Semi-dominant.
|
|
| CB102 |
C. elegans |
unc-10(e102) X. Show Description
Unc. Weak coiler.
|
|
| CB1066 |
C. elegans |
mec-1(e1066) V. Show Description
Mechanosensory abnormal. Small. Lethargic. M-MATING++ 1-10%WT.
|
|
| CB1073 |
C. elegans |
che-5(e1073) IV. Show Description
Unc. Chemotaxis abnormal. Short. Variable Dpyish. M-MATING++ 1-10%WT.
|
|
| CB1111 |
C. elegans |
cat-1(e1111) X. Show Description
Catecholamine abnormal. Recessive. M-MATING++ 1-10%WT. Previously called ctl-2.
|
|
| CB1141 |
C. elegans |
cat-4(e1141) V. Show Description
Catecholamine abnormal. Recessive. M-MATING++ 1-10%WT.
|
|
| CB1220 |
C. elegans |
unc-82(e1220) IV. Show Description
Slightly slow Unc. Movement almost wild-type. Body muscle abnormal. M-MATING++ 1-10%WT.
|
|
| CB128 |
C. elegans |
dpy-10(e128) II. Show Description
Small Dpy.
|
|
| CB1282 |
C. elegans |
dpy-20(e1282) IV. Show Description
Dpy. Temperature sensitive. Lethal cold sensitive. Male lethal. M-MATING++ 1-10%WT.
|
|