More Fields
Strain Species Genotype
CB1111 C. elegans cat-1(e1111) X. Show Description
Catecholamine abnormal. Recessive. M-MATING++ 1-10%WT. Previously called ctl-2.
KP1287 C. elegans nuIs26 IV. Show Description
nuIs26 [cat-1::GFP] IV. nuIs26 contains a full length CAT-1::GFP fusion protein (with GFP fused at the predicted carboxy terminus of CAT-1). This transgene rescues the hyperactive locomotion defect of cat-1(e1111). This strain is slightly sluggish for locomotion and has a high degree of sterility (80%), both of which appear to be associated with the transgene. GFP expression in this strain is similar to the CAT expression pattern described by Duerr et al (1999) J Neurosci 19: 72-84.
RB681 C. elegans cat-1(ok411) X. Show Description
W01C8.6. Homozygous. Outer Left Sequence: CCATTGAATGTGCAACGAAC. Outer Right Sequence: ATGGATTAGCAGTCCATCGC. Inner Left Sequence: TCGAGTGACCTCAAACATGC. Inner Right Sequence: ATGCAAGCATACTGGGAAGG. Inner primer WT PCR product: 2850. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RM1845 C. elegans cat-1(e1111) X. Show Description
Catecholamine abnormal. See Duerr JS, et al. J Neurosci. 1999 Jan 1;19(1):72-84. for description of phenotypes.
DCR3791 C. elegans pfk-1.1(ola72) X. Show Description
Diffuse distribution of synaptic vesicle markers (SNB-1, CAT-1, and RAB-3) under hypoxic conditions. pfk-1.1(ola72) causes C562Y missense mutation. Reference: Jang et al. Neuron. 2016 Apr 20;90(2):278-91.
OH10194 C. elegans ceh-43(tm480) otIs221 III; him-8(e1489) IV; norEx41. Show Description
otIs221 [cat-1::GFP]. norEx41 [ceh-43(fosmid) + dat-1::mCherry]. Him. tm480 embryonic lethality is rescued by extrachromosomal array. Pick mCherry+ animals to maintain.
OH15039 C. elegans pha-1(e2123) III; him-5(e1490) V; otIs625. Show Description
otIs625 [cat-1(fosmid)::SL2::mCherry::H2B + pha-1(+)]. Fosmid-based cat-1 reporter marks aminergic neurons.
OH8249 C. elegans otIs224. Show Description
otIs224 [cat-1(2493bp)::GFP].
OH8480 C. elegans otIs221 III; him-8(e1489) IV. Show Description
otIs221 [cat-1::GFP]. GFP expression in monoaminergic neurons. Reference: Flames N, Hobert O, 2009 Nature 458, 885-889.
OH9279 C. elegans otIs266. Show Description
otIs266 [cat-1p::mCherry]. A 2.5 kb upstream region of cat-1 ATG was cloned into pPD95.75 vector and GFP was replaced with mCherry. Reference: Tursun B, et al. Science. 2011 Jan 21;331(6015):304-8.
OU6 C. elegans png-1(cy9) I; cyIs4. Show Description
cyIs4 [cat-1::GFP + rol-6(su1006)]. Reference: Habibi-Babadi N, et al. J Neurosci. 2010 Feb 3;30(5):1766-76.
RG3078 C. elegans +/szT1 [lon-2(e678) umnIs61] I; bcat-1(ve578[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/szT1 X. Show Description
umnIs61 [myo-2p::mKate2 + NeoR, X: 15420938 (intergenic)] I. Homozygous Let. Deletion of 2704 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 dead larvae (ve578 homozygotes), Lon non-GFP mKate2+ males (szT1 hemizygotes), and dead eggs (szT1 homozygotes and aneuploids). Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: ttaacacccgtatcattatcatttccatgc ; Right flanking sequence: cccaacttccttccaccccctcaaaaagcg. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
TL8 C. elegans bam-2(cy6) I; cyIs4 V. Show Description
cyIs4 [cat-1p::cat-1::GFP + rol-6(su1006)]. Rollers. GFP+. bam-2 phenotype: VC4 and VC5 motorneuron axon branches extend beyond normal termination points.
TL9 C. elegans bam-2(cy7) I; cyIs4 V. Show Description
cyIs4 [cat-1p::cat-1::GFP + rol-6(su1006)]. Rollers. GFP+. bam-2 phenotype: VC4 and VC5 motorneuron axon branches extend beyond normal termination points.
OH16765 C. elegans otIs794. Show Description
otIs794 [cho-1(fosmid)::NLS::SL2::YFP::H2B + eat-4(fosmid)::SL2::LSSmOrange::H2B + unc-47p::tagBFP2 + cat-1p::mMaroon + rab-3p1::2xNLS::tagRFP]. cho-1 fosmid reporter construct labels cholinergic neurons. eat-4 fosmid reporter construct labels glutamatergic neurons. unc-47p::tagBFP2 reporter (contains -2778 to -1 promoter region) labels GABAergic neurons. cat-1p::mMaroon reporter (contains -1599 to -1) labels monoaminergic neurons. rab-3p::tagRFP (contains -1462 to +2921 of prom1) labels all neurons (pan-neuronal marker). Reference: Leyva-Diaz E & Hobert O. Current Biol. 2022 Mar 3;S0960-9822(22)00262-7. PMID: 35259341