Strain Information
Name | CZ9676 View On Wormbase |
---|---|
Species | C. elegans |
Genotype | acr-2(n2595 n2420) X. |
Description | Intragenic suppression of n2420 gain of function; n2595 is a nonsense mutation of acr-2. G to A at residue 525, causing W175-STOP. (WT: CACGGAGATGTGACATGGGTCCCACCTGCAATGTT) (n2595: CACGGAGATGTGACATGAGTCCCACCTGCAATGTT). Reference: Jospin M, et al. PLoS Biol. 2009 Dec;7(12):e1000265. |
Mutagen | EMS |
Outcrossed | x2 |
Made by | Tammy Stawicki |
Laboratory | CZ |
Reference | Jospin M, Qi YB, Stawicki TM, Boulin T, Schuske KR, Horvitz HR, Bessereau JL, Jorgensen EM, Jin Y. A neuronal acetylcholine receptor regulates the balance of muscle excitation and inhibition in Caenorhabditis elegans. PLoS Biol. 2009 Dec;7(12):e1000265. doi: 10.1371/journal.pbio.1000265. Epub 2009 Dec 22. |
Sign in
or
register an account if you want to order this strain.