ABR1 |
C. elegans |
pha-1(e2123) III; staEx1. Show Description
staEx1 [T20F7.6p + pha-1(+)]. Empty vector control strain. Maintain at 25 degrees. Superficially wild-type. Reference: Greer EL et al Curr Biol 2007 Oct 9;17(19):1646-56.
|
|
DC1 |
C. elegans |
bah-1(br1) I. Show Description
Bah (biofilm absent on head - resistant to attachment of Yersinia sp. biofilms). Fragile cuticle (mild): increased sensitivity to alkaline-hypochlorite.
|
|
ABR14 |
C. elegans |
shEx34. Show Description
shEx34 [myo-3p::mCherry]. Pick mCherry+ to maintain. This strain serves as a control strain to ABR16. Reference: Han S, et al. Nature 2017 doi: 10.1038/nature21686.
|
|
ABR156 |
C. briggsae |
Cbr-she-1(v35) IV; mfIs42. Show Description
mfIs42 [Cel-sid-2(+) + Cel-myo-2::dsRed]. Maintain at 15C. Feminization is partially-penetrant at 15C; most hermaphrodites are somewhat self-fertile and can lay small broods. Can be maintained by crossing with male siblings. Feminized C. briggsae strain made susceptible to RNAi knock-down by feeding dsRNA due to the transgenic expression of C. elegans SID-2. Generated by crossing parental strains JU1018 with RE665. Reference: Booth LN, eLife 2019 Jul 8;8:e46418. PMID: 31282863.
|
|
ABR16 |
C. elegans |
shEx1. Show Description
shEx1 [ges-1p::fat-7 + myo-3p::mCherry]. Pick mCherry+ to maintain. FAT-7 over-expressing strain. ABR14 serves as a control strain for this strain. Reference: Han S, et al. Nature 2017 doi: 10.1038/nature21686.
|
|
CB6991 |
C. elegans |
mrp-1(pk89) bus-5(br19) X. Show Description
Skiddy hermaphrodites, bleach-sensitive, drug-hypersensitive, abnormal bacterial pathogen resistance. Reference: Stroud et al (in preparation).
|
|
CB6992 |
C. elegans |
bus-5(br19) pgp-3(pk18) X. Show Description
Hypersensitive to drugs. Resistant to infection by M. nematophilum and Leucobacter Verde2. Hypersensitive to Leucobacter Verde1. Reference: O'Rourke et al. (in preparation).
|
|
DC19 |
C. elegans |
bus-5(br19) X. Show Description
Severe missense mutation. Bus (resistant to M. nematophilum), Bah (resistant to Yersinia biofilm formation), resistant to Leucobacter Verde2, hypersensitive to Leucobacter Verde1, drug and bleach sensitive. Slightly skiddy movement. Useful for drug screening. Reference: Xiong H, et al. Sci Rep. 2017 Aug 29;7(1):9839.
|
|
EK123 |
C. elegans |
cmEx6. Show Description
cmEx6 [(pBR126) mbk-2p::GFP + rol-6(su1006)]. Maintain by picking Rollers.
|
|
EK224 |
C. elegans |
cmIs6 I; unc-4(e120) II. Show Description
cmIs6 [(pBR104) mbk-1::GFP + pNC4.21].
|
|
HBR1000 |
C. elegans |
ceh-24(tm1103) V. Show Description
Flipping defective. Reference: Schwarz J & Bringmann H. eLife 2017;10.7554/eLife.24846.
|
|
HBR1021 |
C. elegans |
goeIs240. Show Description
goeIs240 [hsp-16.2p::flp-11::SL2::mKate2::unc-54 3'UTR + unc-119(+)]. Likely intergrated into LG I or LG III. Heat shock-induced over-expression of FLP-11 neuropeptide causes behavioral quiescence. Reference: Turek et al. eLife 2016;5:e12499.
|
|
HBR1077 |
C. elegans |
goeIs247. Show Description
goeIs247 [ceh-24p::GCaMP6s::mKate2::unc-54 3'UTR + unc-119(+)]. Reporter expresses calcium sensor GCaMP6s with expression control mKate2. Reference: Schwarz J & Bringmann H. eLife 2017;10.7554/eLife.24846.
|
|
HBR1110 |
C. elegans |
unc-119(ed3) III; goeIs257. Show Description
goeIs257 [nas- 38p::d1mGFP::nas-38 3'UTR + unc-119(+)]. Destabilized GFP expressed from the nas-38 promoter; especially visible in hypodermis and excretory system. Reference: Sinner MP, et al. Curr Biol. 2021 Feb 8;31(3):564-577.e12. PMID: 33259791
|
|
HBR1261 |
C. elegans |
goeIs288. Show Description
goeIs288 [flp-11p::mKate2::unc-54 3'UTR + unc-119(+)]. Low copy number insertion. Integration site unknown, but likely not in LG II. Reference: Turek et al. eLife 2016;5:e12499.
|
|
HBR1549 |
C. elegans |
goeIs326. Show Description
goeIs326 [hsp-16.2p::nlp-29::SL2::mKate2::unc-54 3'UTR + unc-119(+)]. Over-expression of nlp-29::SL2::mKate2 after heat shock causes increased quiescence in adults. Reference: Sinner MP, et al. Curr Biol. 2021 Feb 8;31(3):564-577.e12. PMID: 33259791
|
|
HBR1896 |
C. elegans |
goeIs388. Show Description
goeIs388 [hsp-16.2p::cnc-1::SL2::mKate2::unc-54 3'UTR + unc-119(+)]. Over-expression of cnc-1::SL2::mKate2 after heat shock causes increased quiescence in adults. Reference: Sinner MP, et al. Curr Biol. 2021 Feb 8;31(3):564-577.e12. PMID: 33259791
|
|
HBR1897 |
C. elegans |
goeIs397. Show Description
goeIs397 [hsp-16.2p::cnc-10::SL2::mKate2::unc-54 3'UTR + unc-119(+)]. Over-expression of cnc-10::SL2::mKate2 after heat shock. Reference: Sinner MP, et al. Curr Biol. 2021 Feb 8;31(3):564-577.e12. PMID: 33259791
|
|
HBR1899 |
C elegans |
goeIs406. Show Description
goeIs406 [hsp-16.2p::nlp-31::SL2::mKate2::unc-54 3'UTR + unc-119(+)]. Over-expression of nlp-31::SL2::mKate2 after heat shock. Reference: Sinner MP, et al. Curr Biol. 2021 Feb 8;31(3):564-577.e12. PMID: 33259791
|
|
HBR1900 |
C. elegans |
goeIs408. Show Description
goeIs408 [hsp-16.2p::nlp-27::SL2::mKate2::unc-54 3'UTR + unc-119(+)]. Over-expression of nlp-27::SL2::mKate2 after heat shock. Reference: Sinner MP, et al. Curr Biol. 2021 Feb 8;31(3):564-577.e12. PMID: 33259791
|
|
HBR1901 |
C. elegans |
goeIs407. Show Description
goeIs407 [hsp-16.2p::cnc-2::SL2::mKate2::unc-54 3'UTR + unc-119(+)]. Over-expression of cnc-2::SL2::mKate2 after heat shock. Reference: Sinner MP, et al. Curr Biol. 2021 Feb 8;31(3):564-577.e12. PMID: 33259791
|
|
HBR1902 |
C. elegans |
goeIs409. Show Description
goeIs409 [hsp-16.2p::nlp-32::SL2::mKate2::unc-54 3'UTR + unc-119(+)]. Over-expression of nlp-32::SL2::mKate2 after heat shock. Reference: Sinner MP, et al. Curr Biol. 2021 Feb 8;31(3):564-577.e12. PMID: 33259791
|
|
HBR1907 |
C. elegans |
goeIs410. Show Description
goeIs410 [hsp-16.2p::cnc-6::SL2::mKate2::unc-54 3'UTR + unc-119(+)]. Over-expression of cnc-6::SL2::mKate2 after heat shock. Reference: Sinner MP, et al. Curr Biol. 2021 Feb 8;31(3):564-577.e12. PMID: 33259791
|
|
HBR191 |
C. elegans |
goeIs5. Show Description
goeIs5 [nmr-1p::SL1::GCaMP3.35::SL2::unc-54 3'UTR + unc-119(+)]. Reporter allows visualization of several command interneurons. Reference: Schwarz J & Bringmann H. PLoS One. 2013 Sep 20;8(9):e75853.
|
|
HBR1911 |
C. elegans |
goeIs411. Show Description
goeIs411 [hsp-16.2p::cnc-4::SL2::mKate2::unc-54 3'UTR + unc-119(+)]. Over-expression of cnc-4::SL2::mKate2 after heat shock. Reference: Sinner MP, et al. Curr Biol. 2021 Feb 8;31(3):564-577.e12. PMID: 33259791
|
|
HBR1912 |
C. elegans |
goeIs412. Show Description
goeIs412 [hsp-16.2p::cnc-7::SL2::mKate2::unc-54 3'UTR + unc-119(+)]. Over-expression of cnc-7::SL2::mKate2 after heat shock. Reference: Sinner MP, et al. Curr Biol. 2021 Feb 8;31(3):564-577.e12. PMID: 33259791
|
|
HBR1914 |
C elegans |
goeIs413. Show Description
goeIs413 [hsp-16.2p::cnc-9::SL2::mKate2::unc-54 3'UTR + unc-119(+)]. Over-expression of cnc-9::SL2::mKate2 after heat shock. Reference: Sinner MP, et al. Curr Biol. 2021 Feb 8;31(3):564-577.e12. PMID: 33259791
|
|
HBR1961 |
C. elegans |
goeIs431. Show Description
goeIs431 [hsp-16.2p::nlp-25::SL2::mKate2::unc-54 3'UTR + unc-119(+)]. Over-expression of nlp-25::SL2::mKate2 after heat shock. Reference: Sinner MP, et al. Curr Biol. 2021 Feb 8;31(3):564-577.e12. PMID: 33259791
|
|
HBR1971 |
C. elegans |
nlp-42(syb235) V. Show Description
Complete CRISPR/Cas-9 knock-out (2317bp deletion) of the gene nlp-42(Y80D3A.10). Two times backcrossed with N2. Homozygous. Superficial wild-type.
Primers for crossing:
Fwd: cgagacttttaaccccgtcg
InFwd: aaagcccatgacttgctgaa
Rev: gctcaggtggttagagggtt
Wild-type bands: 580bp, 2652bp. Mutation band: 335bp.
|
|